Deoxyribonuclease

Total RNA was extracted from cells by Trizol, respectively. RNA was treated with deoxyribonuclease to dislodge contaminating genomic DNA (Takara Bio Inc., Japan) before reverse transcription. The complementary DNA was synthesized in a 20 μl volume using the Light Cycler kit (Takara Bio Inc., Japan) according to the manufacturer's instructions. β‐actin was as an internal control for DUSP5. The relative expression level between treatments was calculated by 2^{−(ΔCtsample − ΔCtcontrol)}. The primers sequences: DUSP5 F:ATCCTGAGTGTTGCGTGGATGTA R:CTCGCACTTGGATGCATGGTA
β‐actin F:TGGCACCCAGCACAATGAA R:CTAAGTCATAGTCCGCCTAGAAGCA

Following the manufacturer’s instructions, total RNA was extracted from the mouse uterine tissue by treatment with TRIzol and deoxyribonuclease (Takara Biotechnology, Co., Ltd., Dalian, China). The total RNA concentration was measured as previously described [29 (link)]. cDNA was synthesized using a reverse transcription kit (Takara Biotechnology, Co., Ltd., Dalian, China). Extracted total RNA samples and the synthesized cDNAs were stored at −80 °C.