β‐actin F:TGGCACCCAGCACAATGAA R:CTAAGTCATAGTCCGCCTAGAAGCA
Deoxyribonuclease
Deoxyribonuclease, also known as DNase, is an enzyme that catalyzes the hydrolytic cleavage of DNA. It plays a role in the degradation and fragmentation of DNA molecules.
Lab products found in correlation
2 protocols using deoxyribonuclease
Quantitative Analysis of DUSP5 Expression
β‐actin F:TGGCACCCAGCACAATGAA R:CTAAGTCATAGTCCGCCTAGAAGCA
Extracting RNA from Mouse Uterine Tissue
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!