Universal probe library software

Total RNA was purified from immunoprecipitates and ribosomal fractions with TriReagent (Invitrogen) according to the manufacturer’s protocol. The purified RNA was used for qRTPCR. The first strand cDNA template was synthesized from 500 ng of total RNA using random primers and Superscript III reverse transcriptase (Invitrogen, USA). All reactions were performed with SYBR Green PCR Master Mix (BioRad) and carried out in the iCycler (BioRad). Primers for Quantitative PCR (QTR-PCR) analysis were designed with the assistance of Universal Probe Library Software (Roche Applied Science). The Following primers were selected to amplify: Homo sapiens PSD-95, forward GCATGCTGGGAGCTGTAGT and reverse ATCCCTCTAAGTCAGCGGAAC; Homo sapiens RNA, 18S (ribosomal 1 forward) 59-AGGGCAGGGACTTAATCAACGC-39 and reverse 59-GTTGGTGGAGCGATTTGTC TGG-3. Relative change of mRNA amount was calculated based DCt method, as described in [55 (link)].

Primers were designed as previously described [13 (link)]. Primers, synthesized by Eurogentec, were targeted against human sequences of integrin alpha1, alpha2, alpha3, alpha6, alpha7, alphaV, beta1, beta4, beta5, beta6, beta7, beta8, and cyclophilin A and beta-actin as reference genes (Table 1). Every set of primers has been designed using intron spanning assay as required by the Universal Probe Library Software from Roche Diagnosis. Non specific products formation has been verified for each set of primers with the melting curve realized by the LightCycler™ 480 Software.
Real-time pPCR was performed on the LightCycler™ 480 (Roche) using the LightCycler™ 480 SYBR Green 1 Master mix (Roche). The PCR reaction was performed in 20 μl volume containing 16 ng cDNA, 10 μl 2x LightCycler™ 480 SYBR Green 1 Master mix and 1 μl of primer mix (10 μM forward primer, 10 μM reverse primer). The PCR profile was as follows: 5 min at 95°C, followed by 45 cycles of 10 sec at 95°C, 10 sec at 60°C and 10 sec at 72°C.
The Ct value of each gene of interest was normalized to the Ct of the reference genes as follows : ΔCT_norm = Ct_goi-Ct_ref with Ct_ref = (Ct_bACT × Ct_CycloA)^(1/2) with _norm = normalized, _goi = gene of interest, and _ref = reference gene. ΔΔCT = ΔCT experimental condition - ΔCT control condition. Values were expressed as 2^-ΔΔCt normalized using the 10% FCS condition as control.

The reverse transcriptase (RT) reaction was carried out using the iScript™ cDNA synthesis kit (Bio-Rad, CA, USA) in a total volume of 20 ul. One μg of total RNA was incubated with Oligo(dT) as primer for 40 min, at a temperature of 45°C. Real-time PCR reactions were carried out using the LightCycler® 480 Probes Master (Roche, Switzerland) and pair of specific primers and probes designed with the Universal Probe Library software (Roche Diagnostics, Switzerland). RT-qPCR reactions were carried out under the following thermal conditions: 10-min denaturation step for the Taq DNA polymerase activation, then by a two-step amplification program repeated 40 times: denaturation at 95°C for 30 s followed by annealing and extension at 64°C for 60 s. The cycle threshold values obtained for the genes of interest were normalized to hypoxanthine-guanine phosphoribosyltransferase gene (HPRT), which previous studies have shown to be one of the most stable reference genes in the adrenal gland (14 (link)). The expression level for each examined gene was determined using the formula −2^ΔΔct. The reaction was carried out in triplicate for each of analyzed genes.