Cdna rt kit

Total RNA from 10 animals each group was isolated from mesenteric arteries using Tri-Reagent (Invitrogen, CA, USA) and reverse-transcribed to cDNA (cDNA RT kit; Toyobo, Japan). Real-time PCR was performed with SYBR Green detection (SYBR Green Supermix Taq Kit, Takara, Japan) on iCycler, MyiQ two Color Real-Time PCR Detection System (Bio-Rad) according to the manufacturer's instructions. The gene specific primers (Sangon, Shanghai, China) were shown in Table 1. All primers were verified to yield a single PCR product with the correct molecular weight. The PCR conditions were 5 minutes at 95°C, 40 cycles of 15 seconds at 95°C followed by 15 seconds at 60°C and 30 seconds at 72°C. ΔΔCt method was used to comparatively quantify the amount of mRNA.

RT‐qPCR was applied to semi‐quantitatively evaluate the expression levels of Hif‐1α and MDR1. The method of cell culture and pretreatment were similar to that of WB. A group of anoxic cells were incubated with ODP‐TH (5 µg mL⁻¹ PpIX and Dox) for 2 h. Total RNA was extracted from 4T1 cells with Trizol reagent (Sigma, USA), and then reversely transcripted into cDNA with cDNA RT kit (Toyobo, Japan) followed with the instructions from a manufacturer. Then, the RT‐qPCR was carried out by Thunder Bird SYBR qPCR mix (Toyobo, Japan). GAPDH was selected as an endogenous reference. The primers gene sequence of HIF‐1α were 5″‐AGCAATTCTCCAAGCCCTCC (Forward) and CGTAACTGGTCAGCTGTGGT‐3″ (Reverse). The primers gene sequence of MDR1 were 5″‐AGTGGCTCTTGAAGCCGTAA (Forward) and AACACCAGCAT‐CAAGAGGGG‐3″ (Reverse). The primers gene sequence of GAPDH were 5″‐CTACTCGCGGCTTTACGGG (Forward) and CTCGCTCCTGGAAGATGGTG‐3″ (Reverse).