The pCMV-ABE7.10, pCMV-ABE-xCas9(3.7) and pCMV-ABEmax were obtained from Addgene. The NG and other mutations in the PAM domain were introduced by fusion PCR of pCMV-ABEmax and subcloned into pCMV-ABEmax. The A56G and V82G mutations were introduced into TadA* domain by fusion PCR. The CfaN minigene was synthesized by IDTdna and fused at the amino acid 573 of SpCas9-max through PCR amplification. The TadA-TadA*-SpCas9max(2-573)-CfaN fragment was PCR amplified and subcloned into pAAV under the control of meCMV promoter to generate pAAV-ABEmaxN-temp. The hU6 promoter with mdx4cv-targeting gRNA was PCR amplified and cloned into pAAV-ABEmaxN-temp to make pAAV-ABEmaxN. The CfaC fused with SpCas9max(574-end) was generated by PCR and cloned into pAAV-ABEmaxN-temp to make pAAV-ABEmaxC. Similarly, pAAV-ABEmaxN2 and pAAV-ABEmaxC2NG with the Gp41-1 intein, and pAAV-ABEmaxN3 and pAAV-ABEmaxC3NG with the Npu intein were constructed. The mdx4cv gRNA and other gRNA oligos (listed in Supplementary Table S5 ) were annealed and ligated into pLenti-ogRNA. The mdx4cv reporter oligos were annealed and ligated into pLKO-puro-2A-EGFP to form the mdx4cv reporter plasmid as previously described39 (link). All plasmids used in this study are listed in Supplementary Table S6 .
Pcmv abe7
Manufactured by Addgene
PCMV-ABE7.10 is a plasmid vector that provides a template for adenine base editor (ABE) expression. It contains the coding sequence for the ABE7.10 enzyme, a variant of the original adenine base editor. The plasmid also includes a constitutive CMV promoter to drive expression of the ABE enzyme.
Automatically generated - may contain errors
Lab products found in correlation
Pcmv abemax, by Addgene (5 mentions)
Pcmv be3, by Addgene (3 mentions)
Pcmv ancbe4max, by Addgene (3 mentions)
Pcmv abe xcas9 3.7, by Addgene (2 mentions)
Quikchange xl site directed mutagenesis kit, by Agilent Technologies (1 mentions)
Hifi dna assembly kit, by New England Biolabs (1 mentions)
Phusion polymerase, by Thermo Fisher Scientific (1 mentions)
T4 ligase, by New England Biolabs (1 mentions)
Midi prep kit, by Macherey-Nagel (1 mentions)
Mmessage mmachine t7 kit, by Thermo Fisher Scientific (1 mentions)
Clonexpress ultra one step cloning kit, by Vazyme (1 mentions)
Fast site directed mutagenesis kit, by Tiangen Biotech (1 mentions)
Abe8.20 m, by Addgene (1 mentions)
Pcmv t7 spry p2a egfp, by Addgene (1 mentions)
Megashortscript t7 transcription kit, by Thermo Fisher Scientific (1 mentions)
Px459 plasmid, by Addgene (1 mentions)
Megaclear kit, by Thermo Fisher Scientific (1 mentions)
Premix taq, by Takara Bio (1 mentions)
Be4 gam, by Addgene (1 mentions)
Mmessage mmachine t7 ultra kit, by Thermo Fisher Scientific (1 mentions)
8 protocols using pcmv abe7
1
Engineered AAV Vectors for Precision Genome Editing
2
CRISPR Plasmid Construction and Acquisition
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All the gRNA sequences listed (Table S1 ) were synthesized by GENEWIZ Biotechnology, Ltd. (Suzhou, China) and then inserted into the pBluescriptSKII+ U6-sgRNA(F+E) empty plasmid (Addgene #74707) through a BbsI site. pCMV-BE3, pCMV-ABE7.10, pCMV_AncBE4max and pCMV_ABEmax were obtained from Addgene (Plasmid #73021, #102919, #112094 and #112095). NG-AncBE4max, NG-ABEmax, xCas9-AncBE4max and xCas9-ABEmax were kept in this lab.
pJH372, pJH373, pJH375, and pJH376 (mammalian expression of AcrIIA1, AcrIIA2, AcrIIA3, and AcrIIA4) were obtained from Addgene (Plasmid #86839, #86840, #86841, and #86842). pCMV-T7-hAcrVA1-NLS (sv40) (BPK5050), pCMV-T7-hAcrVA2.1-NLS (sv40) (BPK5059), pCMV-T7-hAcrVA2-NLS (sv40) (AAS2283), pCMV-T7-hAcrVA3.1-NLS (sv40) (RTW2624), and pCMV-T7-hAcrVA3-NLS (sv40) (BPK5077) were obtained from Addgene (Plasmid #115136, #115137, #115138, #115139, and #115140). Human codon-optimized AcrIIA5, AcrIIC1, AcrIIC2, and AcrIIC3 [28 (link)] anti-CRISPR sequences (Table S4 ) were synthesized by GenScriptBiotechnology, Ltd. and then inserted into pcDNA3.1(+) expression vectors through BamHI/EcoRI sites.
pJH372, pJH373, pJH375, and pJH376 (mammalian expression of AcrIIA1, AcrIIA2, AcrIIA3, and AcrIIA4) were obtained from Addgene (Plasmid #86839, #86840, #86841, and #86842). pCMV-T7-hAcrVA1-NLS (sv40) (BPK5050), pCMV-T7-hAcrVA2.1-NLS (sv40) (BPK5059), pCMV-T7-hAcrVA2-NLS (sv40) (AAS2283), pCMV-T7-hAcrVA3.1-NLS (sv40) (RTW2624), and pCMV-T7-hAcrVA3-NLS (sv40) (BPK5077) were obtained from Addgene (Plasmid #115136, #115137, #115138, #115139, and #115140). Human codon-optimized AcrIIA5, AcrIIC1, AcrIIC2, and AcrIIC3 [28 (link)] anti-CRISPR sequences (
3
Deactivating Cas9 Nuclease Domains
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We deactivated the remaining nuclease domain of Cas9 from nCBE4 (Addgene #100802), nCBE4-gam (Addgene #100806), pCMV-ABE7.10 (Addgene #102919), pCMV-AncBE4max (Addgene #112094) and pCMB_ABEmax (Addgene #112095). Agilent QuikChange XL Site-Directed Mutagenesis Kit (catalogue # 200517) was used with the following primer sequences:
4
Rapid CRISPR Vector Construction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Synthesized oligos were used for each of the target sgRNAs. The oligos were extended using Phusion polymerase (Thermo Fisher Scientific) and then ligated with the pRG2-GG vector (Addgene 104174) using T4 ligase (NEB). The cloned vector was transformed into competent DH5a cells (Invitrogen). The plasmids were extracted using a Midi Prep Kit (MACHEREY-NAGEL), and the sequences were confirmed by Sanger sequencing analysis (Bionics). Next, pCMV-BE3 (Addgene 73021), pCMV-AncBE4max (Addgene 112094), pCMV-ABE7.10 (Addgene 102919), and pCMV-ABEmax (Addgene 112095) were obtained from Addgene. The newly designed vectors containing dCas9 or CMPs or TadAmax of ABE8e were structured using the HiFi DNA Assembly Kit (NEB). The target sequences are listed in Supplementary Table 1 .
5
Efficient Gene Editing in Mouse Zygotes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We targeted enhancer 1 within the Wap super-enhancer28 (link) (Wap Gene ID: 22373). The Wap-E1 sgRNA (GGCACAGTATGGGCCCTTCT)28 (link), which contains two cytidines and two adenines near the editing window, was designed and synthesized using ThermoFiser’s sgRNA in vitro transcription service. The pCMV-BE4 plasmid (from David Liu’s laboratory) and pCMV-ABE7.10 plasmid (Addgene plasmid #102919) were linearized and then their mRNAs were synthesized in vitro using the mMESSAGE mMACHINE T7 kit (ThermoFisher Scientific). Mouse zygotes were produced by in vitro fertilization (IVF) using eggs collected from eight superovulated C57BL/6N female mice and sperm collected from one C57BL/6N male (Charles River Laboratories). The ABE and BE4 mRNAs (50 ng/ul) were separately microinjected with the sgRNA (20 ng/ul) into the cytoplasm of the IVF zygotes. After culturing overnight in M16 medium, those embryos reached 2-cell stage of development were implanted into oviducts of pseudopregnant foster mothers (Swiss Webster, NY). Mice born to the foster mothers were genotyped and subsequently analyzed by WGS.
6
Versatile Plasmid-Based Base Editing System
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The ABE8e, ABE8.17-m, ABE8.20-m, pCMV-ABE7.10, pCMV_ABEmax, and pCMV-T7-SpRY-P2A-EGFP plasmids were obtained from Addgene (#138489, #136298, #136300, #102919, #112095, and #139989, respectively). The construction of Nme2-ABEmax was described in detail in our previously published study.13 (link) The open reading frames of nNme2Cas9 and SpRYCas9 were amplified by PCR for subsequent assembly into a base-editing architecture backbone using a ClonExpress Ultra One Step Cloning Kit (Vazyme, Nanjing, China). TadA8.17 DNA fragments were synthesized and cloned into nNme2-ABE8.17 and SpRY-ABE8.17 by GenScript Biotech (Nanjing, China). The D10A mutation was introduced into the SpRY-ABE8.17 plasmid. Site-directed mutagenesis was performed using a Fast Site-Directed Mutagenesis Kit (TIANGEN, Beijing, China). To construct the ABE8.17-NL plasmid, the reading frame encoding TadA-8.17 was amplified by PCR and used to replace TadA-8.17 and the linker fragment within ABE8.17-m, thus generating ABE8.17-NL. The sgRNA plasmid was constructed and inserted into the PUC57 and 74,707 vectors. Spacer oligos and sgRNA scaffold oligos were synthesized and cloned into the 74,707 and pUC57-sgRNA expression vectors.
7
Synthesis and Purification of CRISPR Components
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The pCMV-BE3 (#73021), pCMV-ABE7.10 (#102919), saKKH-BE3 (#85170), and BE4-Gam (#100806) plasmids were obtained from Addgene. These plasmids were digested with NotI (NEB, Cat. No. R0189S) and BE3, BE4-Gam, and ABE7.10 mRNAs were synthesized using mMESSAGE mMACHINE T7 Ultra kit (Life Technologies, Cat. No. AM1345). T7-sgRNA cassettes were synthesized by PCR using pX459 plasmid (Addgene, #62988) and primers containing spacer and T7 sequences (Supplementary Table 7 ) with Premix Taq (Takara, Cat. No. R003Q). The sgRNAs were synthesized using the MEGAshortscript T7 Transcription Kit (Life Technologies, Cat. No. AM1354). The mRNAs and sgRNAs were purified using the MEGAclear Kit (Life Technologies, Cat, No. AM1908).
8
Novel CRISPR-Cas9 Adenine Base Editor Variants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The pCMV-ABE7.10, pCMV-ABE-xCas9(3.7) and pCMV-ABEmax were obtained from Addgene. The NG mutations were introduced by fusion PCR of pCMV-ABEmax and subcloned into pCMV-ABEmax to make pCMV-ABEmaxNG. The A56G and V82G mutations were introduced into TadA* domain by fusion PCR and cloned into pCMV-ABEmaxNG to generate pCMV-iABEmaxNG. The CfaN minigene was synthesized by IDTdna and fused at the amino acid 573 of SpCas9-max through PCR amplification.
The TadA-TadA*-SpCas9max(2-573)-CfaN fragment was PCR amplified and subcloned into pAAV under the control of meCMV promoter to generate pAAV-ABEmaxN-temp.
The hU6 promoter with mdx 4cv -targeting gRNA was PCR amplified and cloned into pAAV-ABEmaxN-temp to make pAAV-ABEmaxN. The CfaC fused with SpCas9max(574-end) was generated by PCR and cloned into pAAV-ABEmaxN-temp to make pAAV-ABEmaxC. Similarly, pAAV-ABEmaxN2 and pAAV-ABEmaxC2NG with the Gp41-1 intein were constructed. The mdx 4cv gRNA oligos were annealed and ligated into pLenti-ogRNA. The mdx 4cv reporter oligos were annealed and ligated into pLKOpuro-2A-mdx 4cv -EGFP.
The TadA-TadA*-SpCas9max(2-573)-CfaN fragment was PCR amplified and subcloned into pAAV under the control of meCMV promoter to generate pAAV-ABEmaxN-temp.
The hU6 promoter with mdx 4cv -targeting gRNA was PCR amplified and cloned into pAAV-ABEmaxN-temp to make pAAV-ABEmaxN. The CfaC fused with SpCas9max(574-end) was generated by PCR and cloned into pAAV-ABEmaxN-temp to make pAAV-ABEmaxC. Similarly, pAAV-ABEmaxN2 and pAAV-ABEmaxC2NG with the Gp41-1 intein were constructed. The mdx 4cv gRNA oligos were annealed and ligated into pLenti-ogRNA. The mdx 4cv reporter oligos were annealed and ligated into pLKOpuro-2A-mdx 4cv -EGFP.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!