The largest database of trusted experimental protocols

7 protocols using dna ladder

1

RT-PCR for Stem Cell Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols
RT‐PCR was performed as described previously (Wang et al., 2014). cDNA transcription and PCR were performed using SuperScript III First‐Strand RT‐PCR Kit (Invitrogen). Primers designed by Primer Blast (NCBI Primer BLAST) were used to detect following human genes: OCT4 (forward: 5′‐GGCCACACGTAGGTTCTTGA, reverse: 5′‐CTCCCCACTAGGTTCAGGGA) and HPRT1 (forward: 5′‐GCGTCGTGATTAGCGATGATGAAC, reverse: 5′‐CCTCCCATCTCCTTCATGACATCT). Primers for human NANOG/NANOGP8 were designed to produce a ~ 300‐bp cDNA fragment flanking the nucleotide 144 from the starting codon (forward: 5′‐CCGACTGTAAAGAATCTTCACC, reverse: 5′‐GACAGAAATACCTCAGCCTCC). Sizes of bands were estimated based on expected product length from primer design and DNA ladders (Sigma) on the gel.
+ Open protocol
+ Expand
2

Silk Fibers Isolation and Transfection

Check if the same lab product or an alternative is used in the 5 most similar protocols
Partially degummed silk fibers were purchased from Xiehe Silk Incorporation, Shengzhou, Zhejiang province, China. Lithium bromide (LiBr) (Cat. L108934) was purchased from Aladdin (Shanghai, China). Human dermal fibroblasts (Hs 865.Sk cells) were obtained from American type culture collection (ATCC, Maryland, USA). Cell medium ingredients were purchased from Thermo Fisher Scientific (Grand Island, NY). Human genomic DNA (Cat. CW05655) and Tissue DNA kits were purchased from CWBIO (Beijing, China). DNA ladders and other chemicals were purchased from Sigma–Aldrich (St. Louis, MO). PCR primers were purchased and DNA sequencing was performed at Genewiz (Suzhou, China). Quant-iT PicroGreen DsDNA Reagent (Cat. P11495) were purchased from Thermo Fisher Scientific (Grand Island, NY). pDsRed2-ER vectors were purchased from ClonTech (Cat. 632409, US). PolyJet™ in vitro DNA transfection reagent was purchased from SignaGen Laboratories (MD, US)
+ Open protocol
+ Expand
3

RT-PCR for Pluripotency Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
RT-PCR was performed as described previously (Wang et al., 2014 (link)). cDNA transcription and PCR were done using SuperScript III First-Strand RT-PCR Kit (Invitrogen). Primers designed by Primer Blast (NCBI Primer-BLAST) were used to detect following human genes: OCT4 (forward: 5′-GGCCACACGTAGGTTCTTGA, reverse: 5′-CTCCCCACTAGGTTCAGGGA) and HPRT1 (forward: 5′-GCGTCGTGATTAGCGATGATGAAC, reverse: 5′-CCTCCCATCTCCTTCATGACATCT). Primers for human NANOG/NANOGP8 were designed to produce a ~300 bp cDNA fragment flanking the nucleotide 144 from the starting codon (forward: 5′-CCGACTGTAAAGAATCTTCACC, reverse: 5′-GACAGAAATACCTCAGCCTCC). Sizes of bands were estimated based on expected product length from primer design and DNA ladders (Sigma) on the gel.
+ Open protocol
+ Expand
4

Gel Electrophoresis for On-Chip Amplification Validation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Gel electrophoresis was conducted to confirm the on-chip amplification as follows. A 2% agarose (Bioneer) solution was prepared by microwaving with 30 s pulses for 3 min. A 2 μL aliquot of 10 mg/mL ethidium bromide (EtBr) (Sigma-Aldrich) was added to 50 mL of a 2% agarose solution to visualize the DNA under UV light, and the mixture was solidified in a template. The prepared gel was placed into the gel chamber and filled with 1× TBE (Bioneer) containing 5 μL of 10 mg/mL EtBr. A 2 μL aliquot of eluted RNA from the chip was mixed with 6 μL of loading buffer (Sigma-Aldrich) and loaded carefully along with the DNA ladder (Sigma-Aldrich) into the lanes of the gel. Gel electrophoresis was conducted at 80 V for 1 h until the dye line was approximately 80% of the way down the gel. The gel was carefully placed inside a UV box (Gel documentation system, GDS-200D) to take a photographic image.
+ Open protocol
+ Expand
5

Diabetic Rat Tissue Extraction

Check if the same lab product or an alternative is used in the 5 most similar protocols
Maxime RT Premix Kit was purchased from INtRon Biotechnology (Catalog # 25082, Korea). DNA Ladder (Catalog # P1473), DEPC-treated water (clear colorless liquid) (Catalog #D5758), TritonX100 (liquid colorless to light yellow, CAS #9002-93-1), STZ (white to yellow powder, CAS #18883-66-4) and the primer sequences (dried in 2 ml screw cap tube) were obtained from Sigma-Aldrich, USA. Antibodies were purchased from Novus Biologicals, USA. MT as Glucophage tablets (500 mg white colored, film-coated tablets) and GI as Amaryl (2 mg light pink colored oval shaped, uncoated tablets) were purchased from Eva Pharma, Egypt. Solvents and other associated biochemical reagents were obtained with high grade from Sigma-Aldrich, USA.
+ Open protocol
+ Expand
6

Preparation and Characterization of SERS Substrates

Check if the same lab product or an alternative is used in the 5 most similar protocols
Magnesium chloride hexahydrate (MgCl2⋅6H2O), sodium chloride (NaCl), acetone, and phosphate buffer saline (PBS) were purchased from Sinopharm Chemical Reagent Co., Ltd. (China). Exonuclease III was provided by Thermo Fisher Scientific Co., Ltd. (United States). Tris borate EDTA (TBE) buffer (5×), tris EDTA (TE) buffer (1×), sodium dodecyl sulfate (SDS, 10%, w/v) buffer, loading dye buffer solutions (6×), agarose, and saline-sodium citrate (SSC, 20×) buffer solutions were obtained from Solarbio Science & Technology Co., Ltd. (China). GelRed Neuclic Acid Gel Stain was purchased from Biotium, Inc. (United States). DNA ladder was provided by Sigma-Aldrich Co., Ltd. (China). QIAamp DNA Blood Mini Kit was purchased from Qiagen Co., Ltd. (Germany). All chemicals in our experiments were of analytical grade and used without further purification. Aqueous solutions were prepared using deionized water (≥18 MΩ, Milli-Q, Millipore). The SERS substrates were provided by Nanova Biomaterials Inc. (United States). High-performance liquid chromatography (HPLC)-purified oligonucleotides were provided by Sangon Biotechnology Co., Ltd. (China).
+ Open protocol
+ Expand
7

Agarose Gel Electrophoresis of DNA Amplicons

Check if the same lab product or an alternative is used in the 5 most similar protocols
Amplicons were visualized by agarose gel electrophoresis in 0.8% agarose gels prepared with tris-acetate-EDTA buffer and GelRed (Gold Biotechnology). Both amplicons and DNA ladder (Sigma, cat. D3937) were mixed with 6× loading buffer (30 mM EDTA, 40% glycerol, and 0.2% bromophenol blue) and gels were run at 100 V. DNA bands were visualized in a Gel Documentation System (Major Sciences).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!