Cloneamp hifi

Oligonucleotide primers used in these studies (Supplemental Table 11) were purchased from Sigma-Aldrich. Routine cloning was performed by In-Fusion HD Cloning (TaKaRa Bio Inc.). Routine and high-fidelity PCR amplifications were performed using RedTaq (Denville Scientific) and CloneAmp HiFi (TaKaRa Bio Inc.), respectively. Bb strains were transformed by electroporation (94 (link)). Details regarding generation of Bb strains expressing an IPTG-inducible rpoS allele and IPTG-induction are described in Supplemental Methods.

Total RNA was isolated using RNA-Solv (Omega Bio-tek), and reverse transcribed using Superscript IV (Thermo Fisher) and oligo (dT) as a primer, following the manufacturers’ instructions. Viral cDNA was PCR amplified using CloneAmp HiFi (TaKaRa) in four overlapping amplicons of about 2.2 kb, using the following primers:
For1, TGTACACACGGCTTTTAGGTAGA;
Rev1, GGAAAAGTGTTGCAAGAGCGA;
For2, TGTTCTTCGGGAAATGGGGA;
Rev2, TGCCTGTCCCACACGAATAG;
For3, GTTACGCGTGTCCTTTGACG;
Rev3, AACTTCCGTACCAACGCTCA;
For4, AAAGTTGCGTGGGTTTGTGG;
Rev4, CGTGTAAGCAGGGCAGATAGT.
Amplicons were purified with the NucleoSpin kit (MACHEREY-NAGEL), sheared in a Bioruptor Pico (Diagenode) by twelve cycles of 30 s of sonication and 30 s of cooling in 1.5 ml Bioruptor tubes (Diagenode), mixed in equimolar proportions, and used to prepare the library with the Next ultra II DNA library prep kit (E7645, NEB) using 1 μg of DNA per sample as input. Samples were multiplexed with barcodes (E7335, E7500, E7710, E7730, NEB), and the libraries were sequenced on an Illumina HiSeq 4000 sequencer as paired-end 100 base reads by the GenomEast platform, a member of the ‘France Genomique’ consortium. Image analysis and base calling were performed using RTA version 2.7.7 and bcl2fastq version 2.20.0.422.

Mammalian expression plasmids encoding mouse LFNG (pAPtag2-LFNG), full-length mouse N1 (pcDNA1-N1), and O-fucose site mutants of mouse N1 (pcDNA1-N1-EGF6V, pcDNA1-N1-EGF26V, pcDNA1-N1-EGF27V) were described previously (4 (link)). The RFP plasmid was obtained from Addgene (#12520), the TP1-1 luciferase reporter construct was kind gift from Dr Georg Bornkamm, and the gWIZ β-galactosidase construct was from Gene Therapy Systems. The O-fucose site mutant in N1 EGF16 (pcDNA1-N1-EGF16V) was generated by PCR-directed mutagenesis with primers (Table S9) and CloneAmp HiFi (TAKARA). All mutants were confirmed by sequencing.

Routine cloning was performed using In-Fusion HD Cloning Plus (Takara Bio USA Inc., Mountain View, CA) according to the manufacturer’s instructions. Plasmids were maintained in E. coli Top10 (Life Technologies, Grand Island, NY) or Stellar (TaKaRa, Mountain View, CA) cells and purified using QIAprep spin and midi kits (Qiagen, Valencia, CA). Bacterial genomic DNA was extracted from L. interrogans using the Gentra Puregene Yeast/Bacteria kit (Qiagen) according to the manufacturer’s recommendations. Routine and high-fidelity PCR amplifications were performed using RedTaq (Denville Scientific, Metuchen, NJ, United States) and CloneAmp HiFi (Takara Bio USA Inc., Mountain View, CA), respectively. DNA sequencing was performed by Genewiz, Inc. (Cambridge, MA). Routine sequence analyses were performed using MacVector (version 17.0.1, MacVector, Inc., Cary, NC, United States). Oligonucleotide primers used in these studies were purchased from Sigma-Aldrich (St. Louis, MO); primer sequences are provided in S6 Table.

pLVX-IRES-tdTomato-FlagAkt1 vector was obtained from Addgene (#64831) and flagakt1 was removed creating pLVX-IRES-tdTomato (RTD) control vector. RRM2 and RRM2B fragments were generated using HepG2 endogenous DNA and PCR amplified using Clone Amp HiFi (Takara #639298). Fragments were purified on a DNA gel and extracted (Qiagen #28706), fragments were then inserted into the RTD control vector creating pLVX-IRES-tdTomato-RRM2 and RRM2B respectively. Plasmids were expressed in E. Coli DH5α competent cells (NEB #C2987H) and purified (Qiagen #12165). Purified plasmid was sent for sanger sequencing and the verified plasmids were sent to the vector core for viral packaging. HepG2 cells were transduced with lentiviral particles at a M.O.I of 3 and the FASC sorted for tdTomato expression.

Oligonucleotide primers used these studies are described in S3 Table. Plasmids were purified from E. coli using QIAprep spin and midi kits (Qiagen, Valencia, CA) or NucleoBond PC2000 (TaKaRa, Mountain View, CA). Bacterial genomic DNA was extracted using the Gentra Puregene Yeast/Bacteria kit (Qiagen). Except where noted, routine cloning was performed using the In-Fusion HD Cloning Plus kit (Takara Bio USA Inc., Mountain View, CA). Routine and high-fidelity PCR amplifications were performed using RedTaq (Denville Scientific, Metuchen, NJ, United States) and CloneAmp HiFi (Takara Bio USA Inc., Mountain View, CA), respectively. DNA sequencing was performed by Genewiz, Inc. (Cambridge, MA) and analyzed using MacVector v17.0.1 (MacVector, Inc., Cary, NC, United States). Oligonucleotide primers were purchased from Sigma-Aldrich (St. Louis, MO); S4 Table provides primer sequences.