Log In Sign up
The largest database of trusted experimental protocols

Spectrophotometric nucleic acid quantification

Manufactured by Agilent Technologies
Visit Supplier

The Spectrophotometric nucleic acid quantification is a lab equipment product that measures the concentration and purity of nucleic acid samples, such as DNA and RNA, using ultraviolet (UV) spectroscopy. It provides a quantitative analysis of the nucleic acid content in a sample.

Automatically generated - may contain errors

Lab products found in correlation

Purelink pro 96 genomic dna purification kit, by Thermo Fisher Scientific (2 mentions) Exosap it express pcr product cleanup kit, by Thermo Fisher Scientific (2 mentions)

2 protocols using spectrophotometric nucleic acid quantification

1

Analyzing H. pylori Fur Gene Sequence

Check if the same lab product or an alternative is used in the 5 most similar protocols
Approximately 5×108 CFUs were pelleted by centrifugation and stored at −20°C. DNA was extracted from H. pylori using the PureLink Pro 96 Genomic DNA Purification Kit (Invitrogen). DNA was then used as template to amplify a 500 bp product using fur-specific primers: 5′TCCGCCAAAAAGACAAAAAC3′ and 5′GGGCAAGACTTTCACTTGGA3′. PCR products were prepared for sequence analysis using ExoSAP-IT Express PCR Product Cleanup Kit (Affymetrix), quantified using spectrophotometric nucleic acid quantification (BioTek) and sequenced (GeneWiz). Geneious V. 6.1.8 (Biomatters) was used for subsequent analysis.
Noto J.M., Chopra A., Loh J.T., Romero-Gallo J., Piazuelo M.B., Watson M., Leary S., Beckett A.C., Wilson K.T., Cover T.L., Mallal S., Israel D.A, & Peek R.M. (2017). Pan-genomic analyses identify key Helicobacter pylori pathogenic loci modified by carcinogenic host microenvironments. Gut, 67(10), 1793-1804.
+ Open protocol
+ Expand
2

Fur Gene Amplification and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols
Approximately 5×108 CFUs were pelleted by centrifugation and stored at −20°C. DNA was extracted from H. pylori using the PureLink Pro 96 Genomic DNA Purification Kit (Invitrogen). DNA was then used as template to amplify a 500 bp product using fur-specific primers: 5′ TCCGCCAAAAAGACAAAAAC3′ and 5′ GGGCAAGACTTTCACTTGGA3′. PCR products were prepared for sequence analysis using ExoSAP-IT Express PCR Product Cleanup Kit (Affymetrix), quantified using spectrophotometric nucleic acid quantification (BioTek) and sequenced (GeneWiz). Geneious V. 6.1.8 (Biomatters) was used for subsequent analysis.
Noto J.M., Chopra A., Loh J.T., Romero-Gallo J., Piazuelo M.B., Watson M., Leary S., Beckett A.C., Wilson K.T., Cover T.L., Mallal S., Israel D.A, & Peek R.M. (2017). Pan-genomic analyses identify key Helicobacter pylori pathogenic loci modified by carcinogenic host microenvironments. Gut, 67(10), 1793-1804.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!