The largest database of trusted experimental protocols

2 protocols using pbcl 2 s70

1

Immunoblotting of Apoptosis Regulators

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cell lysates were extracted with cell lysis buffer (Beyotime Biotechnology, Nantong, China), and the protein concentration in the lysates was quantified using a Micro BCA Protein Assay Kit (Sangon Biotech, Shanghai, China). A total of 20–50 μg of each cell lysate sample was loaded for immunoblotting and detected by antibodies that recognize Tubulin, VDAC, AIF, SMAC/DIABLO, cytochrome c (Epitomics, Hangzhou, China), CUL1 (Santa Cruz Biotechnology, Santa Cruz, CA, USA), CDKN1B/P27, CDKN2A/P16, PARP, γH2AX, caspase3, caspase8, caspase9, BCL-2, pBCL-2 (S70), BCL-XL, MCL-1, BID, BAD, BAX, and BIM (Cell Signaling Inc., Danvers, MA, USA).
+ Open protocol
+ Expand
2

Quantitative Analysis of FSTL5 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Quantitative PCR (qPCR) and western blotting were performed as described previously.21 FSTL5 primers: forward 5′‐AACAACTCACGCTTCAAG‐3′; reverse 5′‐TGTATGCTCCAGTATCTTCA‐3′. β‐actin primers: forward 5′‐TGGACTTCGAGCAAGAGATG‐3′; reverse 5′‐GAAGGAAGGCTGGAAGAGTG‐3′. The following primary antibodies were used in the western blotting assays:Anti‐FSTL5 antibody (1:1000; Sigma, St. Louis, MO, USA), β‐actin (1:5000; Santa Cruz Biotechnology, Santa Cruz, CA, USA), proliferating cell nuclear antigen (PCNA, 1:1000; Santa Cruz Biotechnology), Cleaved Caspase‐3 (1:1000; Cell Signaling, Boston, MA, USA), Cleaved Caspase‐8 (1:1000; Cell Signaling), Cleaved Caspase‐9 (1:1000; Cell Signaling), Bax (1:1000; Cell Signaling), Bad (1:1000; Cell Signaling), Puma (1:1000; Cell Signaling), P‐Bcl2(S70) (1:1000; Cell Signaling), P‐Bcl2(T56) (1:1000; Cell Signaling).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!