Pulse field gel electrophoresis

Manufactured by Bio-Rad

Pulse Field Gel Electrophoresis is a specialized technique used for the separation and analysis of large DNA molecules. It utilizes an alternating electric field to effectively separate DNA fragments of high molecular weight, which cannot be easily resolved using conventional gel electrophoresis methods.

Automatically generated - may contain errors

Lab products found in correlation

Pcc2fos vector, by Illumina (1 mentions) Maxplax lambda packaging extract, by Illumina (1 mentions) Phire animal tissue direct pcr kit, by Thermo Fisher Scientific (1 mentions) Nucleobond bac 100, by Takara Bio (1 mentions) Phenol chloroform extraction, by Merck Group (1 mentions)

2 protocols using pulse field gel electrophoresis

HMW DNA Fosmid Library Construction

Check if the same lab product or an alternative is used in the 5 most similar protocols

High-molecular-weight (HMW) DNA was isolated from 7-day cultured mycelia using the CTAB DNA isolation method. Genomic DNA was randomly sheared to approximately 40 kb in size. Then, the sheared molecules were size-selected using Pulse Field Gel Electrophoresis (Bio-Rad, Hercules, CA). The sheared DNA was ligated into the pCC2FOS vector (Epicentre, Madison, WI) after end-repair. The ligations were packaged using MaxPlax Lambda Packaging Extracts (Epicentre). The lambda phages carrying foreign DNA were used to infect EPI300-T1R E. coli cells (Epicentre). Positive fosmid clones were selected using lysogeny broth (LB)-chloramphenicol (12.5 μg/ml) plates. A total of 11,232 clones were selected and transferred to 96-well plates containing frozen LB media and stored at −80 °C.

Luo H., Qian J., Xu Z., Liu W., Xu L., Li Y., Xu J., Zhang J., Xu X., Liu C., He L., Li J., Sun C., Martin F., Song J, & Chen S. (2020). The Wolfiporia cocos Genome and Transcriptome Shed Light on the Formation of Its Edible and Medicinal Sclerotium. Genomics, Proteomics & Bioinformatics, 18(4), 455-467.

+ Open protocol

+ Expand

Generating Transgenic Mouse Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

BAC DNA was purified using NucleoBond BAC 100 (Takara). It was linearized by SgrDI digestion, then purified by phenol/chloroform extraction (Sigma-Aldrich) and the quality of the linearized DNA was checked by pulse-field gel electrophoresis (Bio-Rad). The linearized DNA was then injected at a concentration of 5 ng/uL into fertilized eggs of B6;SJLF2 hybrid mice (Jackson Laboratories) at the Yale Genome Editing Center. Transgenic animals were identified by performing PCR on genomic DNA purified from tail biopsies using the Phire Animal Tissue Direct PCR Kit (Thermo Scientific). The primers used for genotyping were: CreForward : GTTTCACTGGTTATGCGGCG and CreReverse : GGTGCTAACCAGCGTTTTCG. DreForward : TGGTGGATTCCTGCGAAACA and DreReverse : GCTACGAACAGGAAAGCCCT, respectively.

Lee H.W., Xu Y., He L., Choi W., David G., Jin S.W, & Simons M. (2021). The Role of Venous Endothelial Cells in Developmental and Pathologic Angiogenesis. Circulation, 144(16), 1308-1322.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!