Accutase

RPE cells treated with and without 10 μM Y27632 were washed twice with PBS and dissociated using Accutase (Funakoshi, Tokyo, Japan) for 15 minutes; the collected floating and adherent cells were resuspended, at 1.0 × 10⁵ cells/500 μL, in PBS containing 2% FBS (each n = 5) and then incubated with Annexin V-FITC (Annexin V-FITC Kit System for Detection of Apoptosis; Beckman Coulter, Brea, CA, USA) for 15 minutes at room temperature in the dark and stained by 1 mg/mL propidium iodide (PI; 1 : 1000, Dojindo, Kumamoto, Japan) before assay. For cell cycle synchronization, RPE cells were cultured with 2.5 mM thymidine for 24 hours; synchronized cells were washed twice with PBS, cultured in the thymidine-free medium, and dissociated using 0.25% trypsin-EDTA 2, 4, 6, 8, 12, 16, 24, and 36 hours after block release. Lastly, cells were fixed in ethanol (overnight, −20°C) and incubated with RNase (30 minutes, 37°C) and then PI (10 minutes, 4°C). Stained RPE cells were passed through a cell strainer (BD, Franklin Lakes, NJ, USA), and cell profiles were analyzed on a FACSCanto™ II flow cytometer (BD). The data were analyzed using FlowJo software (FlowJo, Ashland, OR, USA).

We used our previous method [18 (link),19 (link)] that was based on a previous report [20 (link)]. Specifically, E14.5 GFP mice were euthanized by cervical dislocation, and their abdomens were opened to collect embryos. The mice were humanely euthanized by decapitation, and the metanephroi were isolated using micro-tweezers under a microscope and then stored on ice in Base Medium consisting of Modified Eagle Medium-α supplemented with 20% fetal bovine serum (SH30910, Hyclone, Logan, UT, USA) and 1% antibiotic–antimycotic (12561-056, Thermo Fisher Scientific, Waltham, MA, USA). After centrifuging at 700× g for 1 min to remove the supernatant, 1 mL of Accutase (AT104-500, Funakoshi, Tokyo, Japan) was added, and the suspension was incubated at 37 °C for 15 min, with manual pipetting every 5 min. The cells were then centrifuged at 300× g for 5 min, and the pellets were resuspended in 1 mL of phosphate-buffered saline (PBS) (045-29795, Wako, Osaka, Japan) and passed through a 40 μm cell strainer (352235, Corning, New York, NY, USA) after the manual pipetting. The filtrate was centrifuged at 300× g for 5 min. After completely removing the supernatant, the pellet was mixed gently by tapping the tube, and the suspension was incubated on ice until transplantation.

iPSCs from patients were dissociated to single cells with accutase (funakoshi, Tokyo, Japan). iPSCs were suspended into 100 micro L of conditioned medium containing bFGF and Y-27632 and infected with HDAdVs for 1 hr at room temperature. Selection with 50 micro g/ml of G418 (WAKO) was performed. After the appearance of colonies resistant to G418, they were picked up and additional selection with 200 nmol/L of FIAU (WAKO) was performed. The genomic DNA of the drug-resistant clones was screened by genomic sequence. To remove the Neo cassette, the cells were dissociated into single cells once again and transfected with pCAG-CreN (kindly provided by Dr. Konosuke Mitani, Saitama medical university) using fugene HD (Promega). The removal of the Neo cassette was confirmed by G418 sensitivity and PCR using Neo-test-primers a-f. Each clone of iPSCs was sequenced and checked the mutation was properly corrected.
LA-primer-F: gggaattcgatgtagaagatgggcctag
LA-primer-R: ttgtcgactgaggcttatctggttgggc
RA-primer-F: aagcggccgcgatggctataaagtgctcgg
RA-primer-R: caggatccttgggttctcaggccagagg
Neo-test-primer a: ctaggcccatcttctacatc
Neo-test-primer b: atagagctgtcctaggccca
Neo-test-primer c: cactcccactgtcctttcct
Neo-test-primer d: ggggccaccaaagaacggag
Neo-test-primer e: gctgggtgggcaagatacta
Neo-test-primer f: agggagcactgatttctggg
Genomic sequence primer outside of targeting vector g: tgtgtgcactgatttcccaa