Ueiris 2 rt pcr system for first strand cdna synthesis kit

Plant samples grounded into powder in liquid nitrogen were processed by NuClean Plant Genomic DNA Kit (CWBIO, Beijing, China) for DNA extraction referring to the manufacturer’s instruction. Total RNA was isolated from various tissues using the OminiPlant RNA Kit (CWBIO, Beijing, China) followed by DNase I digestion to remove DNA contamination according to the manufacturer’s instruction. The purity and concentration of RNA was then assessed by NanoDrop 1000 spectrophotometry (Thermo Scientific, United States). 1 μg of total RNA was reversely transcribed into cDNA using UEIris II RT-PCR System for First-Strand cDNA Synthesis Kit (US Everbright^® Inc., Suzhou, China).

RNA was extracted from maize first sheaths or leaves using an Ultrapure RNA Kit (DNase I) (Order No. CW0597S, CWBIO, Beijing, China). cDNA was generated using UEIris II RT-PCR System for First-Strand cDNA Synthesis Kit (Order No. R2028, US Everbright, Suzhou, China). qRT-PCR was performed with three biological replicates using the Eco^TM Real-Time PCR system (Illumina) and 2x SYBR Green qPCR Master Mix (Order No. 522085, Bimake, Shanghai, China). The Real-Time qRT-PCR program had three steps: step 1 (Hot-Start DNA Polymerase Activation), 95°C for 30 s; step2 (PCR), 40 cycles of 95.0°C for 15 s and 60.0°C for 30 s; step 3 (Melt Curve), 95.0°C for 15 s, 60.0°C for 60 s, increment of 0.3°C increase/cycle to 95.0 and 95.0°C for 15 s. The primers for ZmC2 [chalcone synthase C2 (Zea mays); Ensembl-Plants accession: Zm00001d052673] were CAGAAGGCGATCAAGGAGTG and GGTACATCATGAGGCGGTTC (product size: 151 bp) (Eloy et al., 2017 (link)). ZmTUB2 [beta tubulin 4 (Z. mays); NCBI accession: NP_001105457] was used as internal control for normalization with the primers CTACCTCACGGCATCTGCTATGT and GTCACACACACTCGACTTCACG (product size: 297 bp) (Lin et al., 2014 (link)). The relative transcript levels were calculated using the 2^–ΔΔCT method (Livak and Schmittgen, 2001 (link)).

NuClean Plant Genomic DNA Kit (CWBIO, Beijing, PRC) and OminiPlant RNA Kit (CWBIO, Beijing, PRC) were employed for DNA and RNA extraction following the manufacturer’s instruction accordingly. RNA or DNA contamination in DNA or RNA samples was eliminated by RNase or DNase I provided in the kit referring to the manufacturer’s protocol. Nanodrop 1000 spectrophotometry (Thermo Scientific, USA) was employed to detect the purity and concentration of the RNA samples. For cDNA synthesis, UEIris II RT-PCR System for First-Strand cDNA Synthesis Kit (US Everbright^® Inc., Suzhou, PRC) was used to reversely transcribe 500 ng of RNA into cDNA.