Applied biosystems 7500 fast qpcr system

Transcript numbers of g7466 (CYP52P6—putative terpene degradation) and g2373 (“control” CYP51F1—membrane ergosterols) were determined using an Applied Biosystems 7500 Fast qPCR system (Life Technologies) with PerfeCTa SYBR Green FastMix Kits (Quanta BioSciences) on the above cultures grown in the presence of terpenes. Novel qPCR primers (supplementary table S2, Supplementary Material online) were designed to produce small (∼280 bp), efficiently amplified products. Assays were optimized using annealing gradients and specificities were checked through melting curve analyses. The 20 µl reactions contained: 10 µl 2 × PerfeCTa mix, 0.3 µM (final concentration) of each primer, 5 µl of cDNA template dilutions, and q.s. Milli-Q water. Triplicate (at least) reactions for each sample were run. Quantification was achieved relative to known PCR product standards using 10-fold dilution series ranging from 10⁹ to 10² copies. The standards were 1,000–1,020 bp purified CYP gene products generated from H327 DNA using the primers listed in supplementary table S2, Supplementary Material online. Standard curve r² values were ≥ 0.99 and sample efficiencies averaged 88% for both targets combined.

Four IDO1 SNPs (Supplementary Table 1) were selected based on their ability to tag surrounding variants (r² > 0.8, MAF > 0.05) in the HapMap-CEU population of the International HapMap project, phase III (18 (link)), using Haploview (19 (link)). Since IDO2 gene was not annotated in the International HapMap project, phase III, we selected four tagSNPs based on literature review (20 (link)) and their location across IDO2 coding region (Supplementary Table 1). Patients provided a blood specimen for DNA isolation performed using the QIAamp DNA Mini (Qiagen, Milan, Italy) following the manufacturer's instructions and stored at −20°C. SNP genotyping was performed using KASPar assays (LGC Genomics) according to manufacturer's instructions in an Applied Biosystems 7500 Fast qPCR system (Life Technologies). Genotyping sets comprised randomly selected replicates of previously typed samples and two negative controls (water). Concordant genotyping was obtained for ≥99%. Hardy-Weinberg Equilibrium (HWE), Minor Allele Frequency (MAF) and genotyping rate were determined using Haploview (19 (link)). SNPs with a genotyping rate < 90% were not included in the genetic association testing. No HWE cut-off was applied since both cohorts were composed by affected subjects, and in this situation a deviation from HWE may be indicative of causative effect at the considered loci.

Real-time quantitative PCR assays were performed using an Applied Biosystems 7500 Fast qPCR system (Thermo Fisher Scientific) in a final volume of 25 μL containing 300 ng of a DNA template, 12.5 μL Master Mix (Kapa Probe Fast), 0.4 μL of each primer (100 μM), and 0.2 μL probe (100 μM) (SU canola method) and 0.2 μL of each primer (100 μM), and 0.1 μL probe (100 μM) (CruA method). The step-cycle program was 10 min at 95 °C, followed by 45 cycles of 30 s at 95 °C, and 1 min at 60 °C.

Total RNA extraction was performed using the FastPure Cell/Tissue Total RNA Isolation Kit (Vazyme, RC101-01, Nanjing, China). Subsequently, cDNA synthesis was carried out utilizing the HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) (Vazyme, R312-01/02, Nanjing, China). The RT-PCR was conducted using the QuantiNovaTM SYBR Green PCR kit (cat. 208052, QIAGEN Sciences, Inc., Gaithersburg, MD, USA), and specific primers were utilized for the RT-PCR analysis. Signal analysis was performed using the Applied Biosystems 7500 FAST qPCR system (Thermo Fisher Scientific, Waltham, MA, USA). The expression of mRNAs was normalized to GAPDH. The primers used in this study: TAGLN2: TCCAGAACTGGCTCAAGGATGG; TCTGCTCCATCTGCTTGAAGGC; KRT16: CTACCTGAGGAAGAACCACGAG; CTCGTACTGGTCACGCATCTCA; KRT17: ATCCTGCTGGATGTGAAGACGC; TCCACAATGGTACGCACCTGAC; CRNN: GGAGCTGAAAAGACTCTTGGAGC; CTGTGTGGTCTTCATCCAGCAG; MAL: CCATCACGATGCAAGACGGCTT; AGAACACCGCATGGACCACGTA; GAPDH: GTCTCCTCTGACTTCAACAGCG; ACCACCCTGTTGCTGTAGCCAA.