Gblock dna fragment

Manufactured by Integrated DNA Technologies

Sourced in United States

GBlock DNA fragments are synthetic double-stranded DNA molecules produced by Integrated DNA Technologies. They are designed for a variety of molecular biology applications, such as gene assembly, cloning, and research. GBlock fragments are available in customizable lengths and sequences to meet specific experimental needs.

Automatically generated - may contain errors

Lab products found in correlation

Pjet1.2 vector, by Thermo Fisher Scientific (2 mentions) Quikchange xl site directed mutagenesis kit, by Agilent Technologies (2 mentions) Nap10 sephadex, by GE Healthcare (2 mentions) Mabselect sure protein a resin, by GE Healthcare (2 mentions) Expifectamine 293 transfection reagent, by Thermo Fisher Scientific (2 mentions) Gblocks, by GenScript (1 mentions) Genbuilder cloning kit, by GenScript (1 mentions) Hincii, by New England Biolabs (1 mentions) Oligonucleotide, by Merck Group (1 mentions) Xbai, by New England Biolabs (1 mentions) Pfuultra 2 fusion polymerase, by Agilent Technologies (1 mentions) Rapid dna ligation kit, by Roche (1 mentions) Hace2, by Addgene (1 mentions) Dulbecco phosphate buffered saline (dpbs), by Thermo Fisher Scientific (1 mentions) In fusion, by Takara Bio (1 mentions) Expi293f cells, by Thermo Fisher Scientific (1 mentions) In fusion cloning technology, by Takara Bio (1 mentions) Pcdna3, by Thermo Fisher Scientific (1 mentions) Nebuilder hifi dna assembly master mix, by New England Biolabs (1 mentions)

15 protocols using gblock dna fragment

Endogenous Target Overexpression via Engineered Activators

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

For the overexpression of endogenous targets, an activator protein composed of a catalytically inactive Cas9 protein (dCas9) fused to 10 tandem VP16 units (Long et al. 2015 (link)) was expressed from the ubiquitous promoter eft-3 (plasmid pIK312). In addition, we expressed an MS2-VP64 fusion protein, synthesized as a gBlock DNA fragment (Integrated DNA Technologies) from the ubiquitous promoter eft-3 (plasmid pIK303) as an attempt to potentiate activation efficiency (Konermann et al. 2015 (link)).
Extrachromosomal arrays were created containing 100 ng/µL pIK312 Peft-3::Cas9-VP160, 100 ng/µL pIK303 Peft-3::MS2-VP64, and 20 ng/µL Prab-3::mCherry coinjection marker. The injection mix targeting MINISAT1 contained two gRNAs, at 20 ng/µL each (MSAT1: [g]cggcaatttcggcaattgc) cloned into the pIK292 backbone. The injection mix targeting the minimal promoter in the control strain contained six gRNAs, at 20 ng/µL each [(G)TGCAAATTACGAGCGTTGT, (G)AAATTACGAGCGTTGTAGG, GTTGTAGGGGGCGGAGCGAT, GCGATAGGTCCTATAGGTTT, ATCATCATTCATTCATTCAT, and (G)TCCTCTTTCTGAGCTTCTC], cloned into the pIK292 backbone. Transgenic strains were established in an N2 background.

Padeken J., Zeller P., Towbin B., Katic I., Kalck V., Methot S.P, & Gasser S.M. (2019). Synergistic lethality between BRCA1 and H3K9me2 loss reflects satellite derepression. Genes & Development, 33(7-8), 436-451.

+ Open protocol

+ Expand

Cloning and Sequencing of X. tropicalis hoxc13

Check if the same lab product or an alternative is used in the 5 most similar protocols

The complete coding sequence of X. tropicalis hoxc13 (GenBank accession number XM_002936645.5, nucleotides 78-998), flanked by the sequence TGTAAAACGACGGCCAGTGGATCCGCCACC on the 5′-side and TCTAGAGGTCATAGCTGTTTCCTG on the 3′-side, was synthesized as G-block DNA fragment (Integrated DNA Technologies, IDT). This fragment was amplified using M13 primers (forward: 5′-TGTAAAACGACGGCCAGT-3′ and reverse: 5′-CAGGAAACAGCTATGACC-3′) and cloned at BamHI and XbaI restriction sites in the pCS2+ plasmid^{45 (link)}. The correct sequence of the construct was verified by whole plasmid sequencing (Plasmidsaurus).
For the generation of reporter plasmids, G-blocks (IDT) containing wild-type and mutated proximal promoter regions of X. tropicalis krt34 and krt59 (Supplementary Fig. 6) were inserted into pGL4.10[luc2], linearized by digestion with XhoI and EcoRV, using the Genbuilder® cloning kit (Genscript) according to manufacturer’s instructions. The sequences of the constructs were verified by Sanger sequencing after amplification with the primers 5′-gaatcgatagtactaacatacgctctc-3′ and 5′-GATCTGGTTGCCGAAGATGGG-3′. All plasmids generated in this study were deposited in the BCCM/GeneCorner Plasmid Collection, Ghent University, Ghent, Belgium.

Carron M., Sachslehner A.P., Cicekdal M.B., Bruggeman I., Demuynck S., Golabi B., De Baere E., Declercq W., Tschachler E., Vleminckx K, & Eckhart L. (2024). Evolutionary origin of Hoxc13-dependent skin appendages in amphibians. Nature Communications, 15, 2328.

+ Open protocol

+ Expand

Engineered AP2σ Construct for siRNA Resistance

Check if the same lab product or an alternative is used in the 5 most similar protocols

cDNA encoding AP2σ with a C-terminal Flag-tag was acquired as a gBlock DNA fragment (Integrated DNA Technologies), designed as a Megaprimer (Miyazaki, 2011 (link)) that contained flanking 24-bp-long regions of homology to PMIB6 for its insertion by PCR. Four silent mutations conferring siRNA resistance were designed in the siRNA target sequence 5′-CTTCGTGGAGGTCTTAAACGA-3′ to 5′-TTTTGTAGAAGTCTTAAACGA-3′. The σ2 sequence was altered by point mutation V88D to abrogate the diLeu-motif binding using standard site-directed mutagenesis.

Kadlecova Z., Spielman S.J., Loerke D., Mohanakrishnan A., Reed D.K, & Schmid S.L. (2017). Regulation of clathrin-mediated endocytosis by hierarchical allosteric activation of AP2. The Journal of Cell Biology, 216(1), 167-179.

+ Open protocol

+ Expand

CRISPR-Cas9 Inducible Knockout Experiments

Check if the same lab product or an alternative is used in the 5 most similar protocols

The CRISPR–Cas9-mediated inducible knockout experiments were performed using the lentiviral pCW-Cas9-EGFP plasmid. The plasmid was obtained as follows: the lentiviral pCW-Cas9 plasmid (plasmid no. 50661; Addgene) was subcloned by cutting it with the restriction enzymes HincII and XbaI (New England Biolabs). Next, a gBlock DNA fragment (Integrated DNA Technologies) encoding enhanced green fluorescent protein (eGFP) with complementary overhangs was cloned into the plasmid backbone thus replacing the puromycin resistance gene and generating the pCW-Cas9-EGFP plasmid. Guide RNAs (gRNAs) for the CRISPR knockout experiments were designed with Benchling (https://www.benchling.com) using the human reference genome GRCh38. Oligonucleotides were ordered (Sigma-Aldrich) with complementary overhangs to the lentiviral delivery plasmid backbone pLKO5.sgRNA.EFS.tRFP6572 and listed in Supplementary Table 2.

Alborzinia H., Flórez A.F., Kreth S., Brückner L.M., Yildiz U., Gartlgruber M., Odoni D.I., Poschet G., Garbowicz K., Shao C., Klein C., Meier J., Zeisberger P., Nadler-Holly M., Ziehm M., Paul F., Burhenne J., Bell E., Shaikhkarami M., Würth R., Stainczyk S.A., Wecht E.M., Kreth J., Büttner M., Ishaque N., Schlesner M., Nicke B., Stresemann C., Llamazares-Prada M., Reiling J.H., Fischer M., Amit I., Selbach M., Herrmann C., Wölfl S., Henrich K.O., Höfer T., Trumpp A, & Westermann F. (2022). MYCN mediates cysteine addiction and sensitizes neuroblastoma to ferroptosis. Nature Cancer, 3(4), 471-485.

+ Open protocol

+ Expand

Amplification and Cloning of wtf4 Coding Sequence

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

We amplified the wtf4 coding sequence in three pieces. We amplified the promoter with oligos 633+604 using SZY13 DNA as a template. We amplified the coding sequence from a gBlock DNA fragment (Integrated DNA Technologies, Inc, Coralville) using oligos 605+614. We amplified the sequence downstream of wtf4 using oligos 613+635 and SZY13 genomic DNA as a template. We then stitched the three pieces together using overlap PCR with oligos 633+635. We then digested the product with SacI and ligated the cassette into SacI-digested pSZB188 (Nuckolls et al., 2017 (link)) to generate pSZB199. Intron five was predicted wrong, so there is a mutation at the C-terminus. Within this study, this plasmid was only used to build other plasmids, and when used in subsequent steps, we repaired the C-terminal mutation with the PCR oligos.

Nuckolls N.L., Mok A.C., Lange J.J., Yi K., Kandola T.S., Hunn A.M., McCroskey S., Snyder J.L., Bravo Núñez M.A., McClain M., McKinney S.A., Wood C., Halfmann R, & Zanders S.E. (2020). The wtf4 meiotic driver utilizes controlled protein aggregation to generate selective cell death. eLife, 9, e55694.

+ Open protocol

+ Expand

Generating Chimeric HCN Channel Proteins

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Chimeras between mHCN1 [National Center for Biotechnology Information (NCBI) accession no. NM_010408.3] and hEAG1 (NM_172362.2) were generated in the pUNIV vector (52 (link)) as fusions with the Xenopus laevis codon-optimized gene for mCherry at the 3′ end. Chimeragenesis was done by a QuikChange cloning protocol that involves performing a standard QuikChange mutagenesis reaction in which a PCR-synthesized fragment of interest with terminal arms that anneal to the target plasmid is used in place of mutagenic oligonucleotides. The conditions and reagents used were exactly as previously described (53 (link)). The HCN1 C terminus was deleted following residue A624, analogous to the deletion in hHCN1 used previously in structure determination (19 (link)). Mosaic mutations were similarly introduced by QuikChange cloning using the gBlock DNA fragment (Integrated DNA Technologies). Point mutations were introduced by a QuikChange protocol using high-fidelity PfuUltra II Fusion polymerase (Agilent) and a single mutagenic primer in the reaction. In all cases, the sequence of the entire ORF was verified by Sanger sequencing of both DNA strands. Chimeras with spHCN (NCBI accession no. NM_214564.1) or mHCN2 (NM_008226.2) were generated in the psGEM vector.

Cowgill J., Klenchin V.A., Alvarez-Baron C., Tewari D., Blair A, & Chanda B. (2018). Bipolar switching by HCN voltage sensor underlies hyperpolarization activation. Proceedings of the National Academy of Sciences of the United States of America, 116(2), 670-678.

+ Open protocol

+ Expand

Generation of Synechocystis Vipp1 Mutants

Check if the same lab product or an alternative is used in the 5 most similar protocols

To create the Synechocystis mutants as well as a control strain, a construct was designed containing the vipp1 gene with its flanking non-coding regions up to 549 bp upstream and 47 bp downstream of the vipp1 gene. A kanamycin resistance cassette (sequence taken from pBSL14 (ATCC 87127)) was inserted 149 bp upstream of vipp1. The construct was ordered as a gBlock DNA fragment (Integrated DNA Technologies), blunt-cloned in the pJET1.2 vector (Thermo Fisher Scientific) and subsequently subjected to sitedirected mutagenesis (QuikChange XL Site-Directed Mutagenesis Kit, Agilent Technologies) according to manufacturer's instructions to introduce the mutations F4E or V11E (primer pairs: vipp1-F4E-for + vipp1-F4E-rev, vipp1-V11E-for + vipp1-V11E-rev; Table S1). The sequences of both mutant constructs as well as the control construct were verified by sequencing, and the constructs were transformed into Synechocystis wild-type cells as previously described (Eaton-Rye, 2004) . Complete segregation of the resulting control and mutant strains was verified by PCR (primers vipp1-seq-for + vipp1-seq-rev; Table S1), and the insertion of the mutations during homologous recombination was confirmed again by sequencing (primer vipp1-seq-rev).

Gupta T.K., Klumpe S., Gries K., Heinz S., Wietrzynski W., Ohnishi N., Niemeyer J., Spaniol B., Schaffer M., Rast A., Ostermeier M., Strauss M., Plitzko J.M., Baumeister W., Rudack T., Sakamoto W., Nickelsen J., Schuller J.M., Schroda M, & Engel B.D. (2021). Structural basis for VIPP1 oligomerization and maintenance of thylakoid membrane integrity. Cell, 184(14).

+ Open protocol

+ Expand

Generating Synechocystis Mutants Using vipp1

Check if the same lab product or an alternative is used in the 5 most similar protocols

To create the Synechocystis mutants as well as a control strain, a construct was designed containing the vipp1 gene with its flanking non-coding regions up to 549 bp upstream and 47 bp downstream of the vipp1 gene. A kanamycin resistance cassette (sequence taken from pBSL14 (ATCC 87127)) was inserted 149 bp upstream of vipp1. The construct was ordered as a gBlock DNA fragment (Integrated DNA Technologies), blunt-cloned in the pJET1.2 vector (Thermo Scientific) and subsequently subjected to site-directed mutagenesis (QuikChange XL Site-Directed Mutagenesis Kit, Agilent Technologies) according to manufacturer's instructions to introduce the mutations F4E or V11E (primer pairs vipp1-F4E-1 + vipp1-F4E-2 and vipp1-V11E-1 + vipp1-V11E-2, Supplemental Table 3). The sequences of both mutant constructs as well as the control construct were verified by sequencing and transformed into Synechocystis wild-type cells as previously described (Eaton-Rye, 2004) . Complete segregation of the resulting control and mutant strains was verified by PCR (primers vipp1-seg-fw and vipp1seg-rev, Supplemental Table 3), and the insertion of the point mutations during homologous recombination was confirmed again by sequencing (primer vipp1-seg-rev, Supplemental Table 3).

Gupta T.K., Klumpe S., Gries K., Heinz S., Wietrzyñski W., Ohnishi N., Niemeyer J., Schaffer M., Rast A., Strauss M., Plitzko J.M., Baumeister W., Rudack T., Sakamoto W., Nickelsen J., Schuller J.M., Schroda M., & Engel B.D. (2020). Structural basis for VIPP1 oligomerization and maintenance of thylakoid membrane integrity.

+ Open protocol

+ Expand

Recombinant Expression of ACP Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

ACP DNA sequences flanked with NdeI/EcoRI or NdeI/BamHI restriction sites were ordered as gBlock DNA fragments from Integrated DNA Technologies (IDT) for insertion into a pET28a vector for expression of the encoded ACPs with an N-terminal His₆-tag. The gBlock DNA was digested with the appropriate restriction enzymes, gel-purified, and cloned into the corresponding sites of pre-digested pET28a vector using the Roche Rapid DNA Ligation kit. Mutagenic PCR was used to obtain Ec-ACP mutant plasmids. See Supporting Information for details.

Rivas M., Courouble V.C., Baker M.C., Cookmeyer D.L., Fiore K.E., Frost A.J., Godbe K.N., Jordan M.R., Krasnow E.N., Mollo A., Ridings S.T., Sawada K., Shroff K.D., Studnitzer B., Thiele G.A., Sisto A.C., Nawaal S., Huff A.R., Fairman R., Johnson K.A., Beld J., Kokona B, & Charkoudian L.K. (2018). The Effect of Divalent Cations on the Thermostability of Type II Polyketide Synthase Acyl Carrier Proteins. AIChE journal. American Institute of Chemical Engineers, 64(12), 4308-4318.

+ Open protocol

+ Expand

Construction of SARS-CoV-2 Spike Expression Plasmid

Check if the same lab product or an alternative is used in the 5 most similar protocols

The expression plasmid pEC117-Spike-V5 was generated as follows: the SARS-CoV-2 wild type protein (NCBI accession number NC_045512.2, position 21563-25384) was codon-optimised and synthesized in two fragments of approximately 2 kb each as gBlock DNA fragments (IDT Integrated DNA Technologies) with the in-frame addition of the V5 tag at the C-terminus, and then cloned into the pZac 2.1 backbone under the control of the cytomegalovirus (CMV) IE promoter. The construct DNA sequences were verified by Sanger sequencing. The following expression vectors were used: hTMEM16A (GenScript OHu26085D), hTMEM16F (GenScript OHu26351D), hACE2 (Addgene 1786), pGCaMP6s (Addgene 40753), pMERS-CoV-S and pSARS-CoV-1-S (W. Barclay laboratory), pCMV-EGFP and pmCherry-NLS (the last two obtained from L. Zentilin, ICGEB, Trieste, Italy).

Braga L., Ali H., Secco L., Chiavacci E., Neves G., Goldhill D., Penn R., Jimenez-Guardeño J.M., Ortega-Prieto A.M., Bussani R., Cannatà A., Rizzari G., Collesi C., Schneider E., Arosio D., Shah A.M., Barclay W.S., Malim M.H., Burrone J, & Giacca M. (2021). Drugs that inhibit TMEM16 proteins block SARS-CoV-2 Spike-induced syncytia. Nature, 594(7861), 88-93.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!