Pgem t easy vector

Manufactured by Promega

Sourced in United States, China, Germany, United Kingdom, Japan, France, Italy, Australia, Switzerland, Spain, Israel, Canada

The pGEM-T Easy Vector is a high-copy-number plasmid designed for cloning and sequencing of PCR products. It provides a simple, efficient method for the insertion and analysis of PCR amplified DNA fragments.

Automatically generated - may contain errors

Lab products found in correlation

Trizol reagent, by Thermo Fisher Scientific (96 mentions) Qiaquick gel extraction kit, by Qiagen (82 mentions) Ez dna methylation gold kit, by Zymo Research (56 mentions) Epitect bisulfite kit, by Qiagen (55 mentions) Bigdye terminator v3.1 cycle sequencing kit, by Thermo Fisher Scientific (44 mentions) Qiaprep spin miniprep kit, by Qiagen (43 mentions) Qiaquick pcr purification kit, by Qiagen (40 mentions) Dig rna labeling kit, by Roche (39 mentions) Wizard sv gel and pcr clean up system, by Promega (38 mentions) Trizol, by Thermo Fisher Scientific (37 mentions) Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (34 mentions) Rneasy mini kit, by Qiagen (31 mentions) Gel extraction kit, by Qiagen (30 mentions) Ez dna methylation kit, by Zymo Research (26 mentions) Rneasy plant mini kit, by Qiagen (26 mentions) Firstchoice rlm race kit, by Thermo Fisher Scientific (26 mentions) Smarter race cdna amplification kit, by Takara Bio (23 mentions) Ez dna methylation direct kit, by Zymo Research (22 mentions) Smart race cdna amplification kit, by Takara Bio (20 mentions) Gotaq dna polymerase, by Promega (20 mentions)

2 937 protocols using pgem t easy vector

Isolation and Characterization of AvTCTP Gene

Check if the same lab product or an alternative is used in the 5 most similar protocols

Based on the partial sequence of AvTCTP cDNA, the 3′ end was obtained by PCR-RACE (rapid amplification of cDNA ends) using the SMART RACE cDNA application kit (Clontech, Mountain View, CA, USA) and the 3′ AvTCTP primer (Table 1) as described in the user manual. The 3′ RACE product was cloned into the pGEM-T Easy vector (Promega, USA) and transformed into XL1- Blue Escherichia coli cells (Stratagene, San Diego, CA, USA). Plasmid DNA, from three independent clones, was purified on Illustra™ plasmidPrep Mini SpinKit (GE Healthcare Life Sciences, Chicago, IL, USA) and sequenced using T7 and SP6 primers.
The full-length cDNA, consisting in sequences from original expressed sequence tags (ESTs) and additional elements from 3′ RACE product was amplified using an appropriate pair of primers (FlTCTP Fw/Rv) cloned in into the pGEM-T Easy vector (Promega) and the nucleotide sequence was verified using T7 and SP6 sequencing primers. Based on the 5′- and 3′-UTR (untranslated region) sequences, the primer set FlTCTP Fw/Rv was used to isolate the genomic DNA sequences.

Nicosia A., Bennici C., Biondo G., Costa S., Di Natale M., Masullo T., Monastero C., Ragusa M.A., Tagliavia M, & Cuttitta A. (2018). Characterization of Translationally Controlled Tumour Protein from the Sea Anemone Anemonia viridis and Transcriptome Wide Identification of Cnidarian Homologues. Genes, 9(1), 30.

+ Open protocol

+ Expand

Peach xylanase gene cloning and sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Prunus persica full-length cDNA encoding PpXyl was amplified by RT-PCR using RNA extracted from 'Springlady', 'Rojo 2' and 'Flordaking' fruits (Meisel et al. 2005) . Amplification was conducted using SuperScript II reverse transcriptase (Invitrogen) and XylF (5 0 -GTCGACCGTCCACCCTTTGCTTG-3 0 ) and XylR (5 0 -GCGGCCGCAACCTTAATTTCTCC-3 0 ) primers. The PCR products were cloned into pGEM-T Easy Vector (Promega) and sequenced. Genomic DNA was isolated from young peach leaves (cvs 'Springlady', 'Rojo 2', 'Flordaking') according to Dellaporta et al. (1983) . Promoter region of the PpXyl gene was cloned by using pXylF (5 0 -GGAGAAACTCACGCACTCG-3 0 ) and pXylR (5 0 -GGACGAGCATGGACAACTC-3 0 ) primers. The PCR products were cloned into pGEM-T Easy Vector (Promega) and sequenced.

Genero M., Gismondi M., Monti L.L., Gabilondo J., Budde C.O., Andreo C.S., Lara M.V., Drincovich M.F, & Bustamante C.A. (2016). Cell wall-related genes studies on peach cultivars with differential susceptibility to woolliness: looking for candidates as indicators of chilling tolerance. Plant cell reports, 35(6).

+ Open protocol

+ Expand

Cloning and Transformation of Rice RDR Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Full‐length cDNA of OsRDR3 was amplified from Oryza sativa indica Pusa Basmati 1 (PB1) callus and cloned into the pGEM‐T easy vector (Promega). For generating RDR3 OE lines of rice, RDR3 (coding sequence of 2499 bp; 832 aa) was cloned into the pCAMBIA1300 vector. RDR3 amiR construct was designed using WMD tool (http://wmd2.weigelworld.org). For generating GFP‐RDR3 OE transgenic Nicotiana tabacum, RDR3 was cloned into modified the pCAMBIA1300 vector containing an N‐terminal mGFP tag. For translational fusion of RDR3 with maltose‐binding protein (MBP), RDR3 was cloned into the modified pMAL–p5E vector (NEB, Ipswich, MA, USA) having an N‐terminal MBP tag under the tac promoter. For creating mutation in the conserved catalytic domain, the MBP‐RDR3 plasmid was amplified by RDR3_MBP_D‐A mut._fw and RDR3_MBP_D‐A mut._Rv. primers (Supporting Information Table S1) to substitute the 693^rd D to A, treated with DpnI (NEB) and transformed into Escherichia coli DH5α competent cells. OsRDR4 was amplified from PB1 and cloned into the pGEM‐T easy vector (Promega). For generating GFP‐RDR4 OE lines of rice, RDR4 was cloned into the pCAMBIA1300 vector by GIBSON assembly. The RDR4 amiR construct, where amiR was driven by the maize ubiquitin promoter was designed using the WMD tool (http://wmd2.weigelworld.org).

Jha V., Narjala A., Basu D., T. N. S., Pachamuthu K., Chenna S., Nair A, & Shivaprasad P.V. (2021). Essential role of γ‐clade RNA‐dependent RNA polymerases in rice development and yield‐related traits is linked to their atypical polymerase activities regulating specific genomic regions. The New Phytologist, 232(4), 1674-1691.

+ Open protocol

+ Expand

Cloning and Characterization of Galectin-8 from Paracentrotus lividus

Check if the same lab product or an alternative is used in the 5 most similar protocols

We used a sequence predicted to code for a Galectin protein in the sea urchin Strongylocentrotus purpuratus database (accession number XP_781871.1) for BLAST screening against P. lividus EST databases available at NCBI and MPIMG (http://goblet.molgen.mpg.de/cgi-bin/webapps/paracentrotus.cgi). Three overlapping P. lividus EST clones were identified and used to design specific primers (MWG, Heidelberg, Germany). Purified total RNA extracted from the gastrula stage was used to amplify by One Step RT-PCR (Invitrogen), a partial sequence of the 5′ CDS region. We used a 3′RACE kit (Invitrogen) to identify the 3′-terminal end of the sequence. The amplification products were cloned in the pGEM-T-Easy Vector (Promega) and sequenced (MWG, Heidelberg, Germany). The full-length 1309nt sequence was deposited to the EMBL databank, Acc Num: FR716469. New primers were designed to obtain by RT-PCR the amplification of the complete CDS (5′-ATGGCATACCCATACCCACAAGC-3′ as forward and 5′-GCACCCGAAAAATCATCCCTAC-3′ as reverse), which was cloned in the pGEM-T-Easy vector (Promega) and re-sequenced for validation. The obtained recombinant plasmid was referred to as pGEM-T-Easy-Pl-galectin-8.

Karakostis K., Costa C., Zito F, & Matranga V. (2015). Heterologous expression of newly identified galectin-8 from sea urchin embryos produces recombinant protein with lactose binding specificity and anti-adhesive activity. Scientific Reports, 5, 17665.

+ Open protocol

+ Expand

Isolation and Characterization of Nematode FLP Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Freshly hatched J2s of M. incognita were collected and total RNA was isolated using NucleoSpin RNA extraction kit (Macherey-Nagel, Germany). RNA quality and quantity was analyzed using NanoDrop-2000 (Thermo Fisher Scientific, United States) and about 500 ng of total RNA was reverse transcribed to complementary DNA (cDNA) with cDNA synthesis Kit (Superscript VILO, Invitrogen, United States).
To design the primers for FLPs, sequences of Mi-flp1 (KC517344.1), Mi-flp12 (AY804187.1), and Mi-flp18 (AY729022.1) of M. incognita available in GenBank were used and aligned in the ClustalX version 1.81 (Thompson et al., 1997 (link)). Conserved nucleotide sequences were used and primers were designed using IDT OligoAnalyzer, and primer sequences are given in Supplementary Table S1. Selected genes were PCR amplified from cDNA and cloned into pGEM-T easy vector (Promega, United States) and confirmed the target gene inserts by sequencing. Selected sequences of Mi-flp1, Mi-flp12, and Mi-flp18 were further used for designing the fusion gene cassette by placing the three sequences continuously and synthesized artificially by Biomatik Custom Gene Synthesis (Biomatik Technologies, United States) and sub-cloned into pGEM-T easy vector (Promega, United States).

Banakar P., Hada A., Papolu P.K, & Rao U. (2020). Simultaneous RNAi Knockdown of Three FMRFamide-Like Peptide Genes, Mi-flp1, Mi-flp12, and Mi-flp18 Provides Resistance to Root-Knot Nematode, Meloidogyne incognita. Frontiers in Microbiology, 11, 573916.

+ Open protocol

+ Expand

Molecular Characterization of Mite CP Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

To characterize CP genes of TFMs and NFMs, we amplified a segment of CPs via nested PCR using primers shown in S1 Table. Primers were designed based on nucleotide sequences of a conserved region of CPs of Dermanyssus gallinae (HZ459284, KR697573) and other mite species including Varroa destructor (XM 022808259, XM 022835169), and Metaseiulus occidentalis (XM 018640260). Amplified fragments were cloned into a pGEMT easy vector (Promega, Madison, WI, USA) and nucleotide sequences were analyzed using a Beckman CEQ GeXP automated sequencer (Beckman Coulter Inc., Brea, CA). Based on partial sequences of CPs of TFMs and NFMs, we designed primers for 3′ and 5′ RACE to amplify the open reading frames (ORFs) of CPs. We performed 3′ and 5′ RACE PCR using the RACE system (Invitrogen) in accordance with the manufacturer’s protocol. 5′ and 3′ RACE PCR products were separated via agarose gel electrophoresis, purified, cloned into the pGEMT-Easy vector (Promega), and transformed into competent DH5α Escherichia coli cells.

Win S.Y., Murata S., Fujisawa S., Seo H., Sato J., Motai Y., Sato T., Oishi E., Taneno A., Htun L.L., Bawm S., Okagawa T., Maekawa N., Konnai S, & Ohashi K. (2023). Characterization of cysteine proteases from poultry red mite, tropical fowl mite, and northern fowl mite to assess the feasibility of developing a broadly efficacious vaccine against multiple mite species. PLOS ONE, 18(7), e0288565.

+ Open protocol

+ Expand

Cloning and Sequencing of Sucrose Transporter

Check if the same lab product or an alternative is used in the 5 most similar protocols

Two highly conserved regions were identified by amino acid sequence alignment of existing cloned sucrose transporters from plants. The cDNA samples derived from leaves of tree peony cv. 'Huhong' were amplified using primers deduced from conserved regions. The resulting PCR fragment was cloned into Pgem-T Easy vector (Promega, Madison, WI, USA) and sequenced. The remainder of the cDNA was produced using 5'-and 3'-RACE PCR, performed using nested PCR with the gene-specific primers derived from the newly isolated partial fragment and the SMARTer RACE cDNA amplification kit (Clontech, Palo Alto, CA, USA). Amplification products of 5'-RACE and 3'-RACE were cloned into Pgem-T Easy vector (Promega) and sequenced. Following end-to-end PCR, the resulting DNA fragment was sequenced and then BLAST searched against the GenBank database.

Li Y.H., Guo T., Cui Y., Li Y, & He D. (2015). Cloning and expression of the sucrose transporter gene PsSUT1 from tree peony leaf. Genetics and molecular research : GMR, 14(4).

+ Open protocol

+ Expand

Cloning and Sequencing of JcR1MYB1

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Rapid amplification of cDNA ends (RACE) was used to obtain the DNA sequence encoding a putative R1-MYB TF on the genome based sequence at http://www.kazusa.or.jp/jatropha/ (Sato et al., 2011 (link)). Moreover, 3′- and 5′-RACE were conducted using the double-stranded cDNA from J. curcas as a template. The primers used for the 3′ RACE and the 5′ RACE were designed based on the sequence (Table 1). The amplified product was purified (Tiangen, China) and cloned into the pGEM-T easy vector (Promega, USA) and then sequenced. The sequences were compared with those in the NCBI database using the basic local alignment search tool (BLAST). Based on the 5′ and 3′ end cDNA sequences, primers were designed to enable amplification of the entire JcR1MYB1. The amplified products were purified (Tiangen, China) and cloned into the pGEM-T easy vector (Promega, USA) and then sequenced.

Li H.L., Guo D, & Peng S.Q. (2014). Molecular characterization of the Jatropha curcas JcR1MYB1 gene encoding a putative R1-MYB transcription factor. Genetics and Molecular Biology, 37(3), 549-555.

+ Open protocol

+ Expand

Sequencing of Small RNA Cleavage Products

Check if the same lab product or an alternative is used in the 5 most similar protocols

For in vitro processing, the bands corresponding to oligonucleotides in the vicinity of 21 nt were eluted from gel slices and coprecipitated with glycogen. A 5′ adaptor and a 3′ adaptor were ligated to the RNA cleavage products sequentially. Reverse transcription-PCR (RT-PCR) was carried out with the adaptor-ligated RNA cleavage products. PCR fragments were cloned into the pGEM-T-easy vector (Promega) and sequenced with M13F primer. Sequences were analyzed with Vector NTI software (Invitrogen).
For 5′ RACE PCR, RNA samples were isolated from the seedlings of Col, hyl1-2 and hyl1-3. Hundred picomoles of 5′ adaptor (rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCrGrArCrGrArUrC) were directly ligated with 5 μg of total RNA. After ligation, first-strand cDNAs were synthesized using Superscript III Reverse Transcriptase (Invitrogen) and an RNA-specific primer (5′ RACE outer reverse). The cDNA was treated with RNase H to remove the RNA strand and amplified in two rounds using two sets of primers (5′ RACE outer forward and 5′ RACE outer reverse, and 5′ RACE inner forward and 5′ RACE inner reverse). The distinct PCR products were cloned into the pGEM-T-easy vector (Promega) and sequenced using either M13 forward or M13 reverse primers.

Yang X., Ren W., Zhao Q., Zhang P., Wu F, & He Y. (2014). Homodimerization of HYL1 ensures the correct selection of cleavage sites in primary miRNA. Nucleic Acids Research, 42(19), 12224-12236.

+ Open protocol

+ Expand

Cloning and Overexpression of JcBSP1 in Arabidopsis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The primers XD423 (CGAGCTCATGGCTATGGCGACGGTGAT) and XD424 (CGGATCCTCACTCTTCATCATAACGGA) carrying SacI and BamHI restriction sites, respectively, were used to clone the full-length JcBSP1 CDS. Then, the PCR product was cloned into the pGEM-T Easy vector (Promega, Madison, WI, USA). To generate the 35S:JcBSP1 overexpression vector, SacI and BamHI were used to digest the plant transformation vector pOCA30 (Chen & Chen, 2002 (link)) and the pGEM-T Easy vector containing the JcBSP1 sequence, respectively, and then, the resulting fragments were ligated by using T4 DNA Ligase (Promega). The generated 35S:JcBSP1 plasmid was transferred to Agrobacterium tumefaciens EHA105. Transformation of Arabidopsis was performed using the floral dip method (Clough & Bent, 1998 (link)).

Zhang M.J., Fu Q., Chen M.S., He H., Tang M., Ni J., Tao Y.B, & Xu Z.F. (2022). Characterization of the bark storage protein gene (JcBSP) family in the perennial woody plant Jatropha curcas and the function of JcBSP1 in Arabidopsis thaliana. PeerJ, 10, e12938.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!