Sybr green qpcr mix

Total RNA was prepared from AML cells by using a SPARKeasy Improved Tissue/Cell RNA kit (SparkJade, Jinan, China) according to the manufacturer’s protocol. RNA yield was determined using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA). Complementary DNA was synthesized using a SPARKscript II RT Plus Kit (SparkJade, Jinan, China). Quantitative polymerase chain reaction (qPCR) assays were performed using a 2× SYBR Green qPCR Mix (SparkJade, Jinan, China) in a 20 μL reaction volume, by Roche QRT-PCR System according to the manufacturer’s protocol. The messenger RNA (mRNA) levels of target genes were normalized to the mRNA level of β-actin. The sequences of the primers used for the APOBEC3G were: forward, 5’-TTGCCCGCCTCTACTACTTCTGG-3’ and the reverse, 5’-CTTGCTCCAACAGTGCTGAAATTCG-3’ (Sangon Biotech, Shanghai, China). The cycling conditions used were: initial denaturation at 94 °C for 3 min, followed by 40 cycles at 94 °C for 10 s, 60 °C for 30 s.

We extracted total RNA from cells in each group with a SPARK easy Improved Tissue/Cell RNA kit (Spark Jade: AC0202) in the light of the manufacturer's recommended procedures. Briefly, we added lysis solution to the treated NP cells in each groups, which were centrifuged at 13400 × g for 60 seconds. Next, an equivalent volume of 70% ethanol was added, and the solution was immediately purified over an RA adsorption column. Afterward, we added 700 μl deproteinized solution RW1 to the RW absorption tube. Then, the procedure which the RW rinsing solution was added and centrifuged was repeated twice. The RA adsorption column was placed back into an empty collecting tube. Finally, total RNA was extracted by adding sterile enzyme-free water to RNA adsorption columns and centrifugation. After the RNA concentration was determined by spectrophotometry, they are used to obtain cDNA with an SPARK script IIRT Plus Kit (Spark Jade: AG0304). The qPCR reaction which was mixed with 2 × SYBR Green qPCR Mix (Spark Jade: AH0104) was set at 94°C for 3 minutes. After the incubation at 94°C for 10 s and 60°C for 30 s. The relative expression levels of target genes and reference genes were quantified by 2^−ΔΔCT method. We used glyceraldehyde-3-phosphate dehydrogenase (GAPDH) for the purpose of an internal control. The primers used are listed in Table 2.

Total RNA was extracted using according to the manufacturer’s instructions (YiFeiXue, Nanjing, China). qRT–PCR was performed using the 2×SYBR Green qPCR Mix (Shandong Sparkjade Biotechnology Co., Ltd., Shandong, China). The primer sequences are listed in the Table 1.
Table 1

List of oligonucleotides used for qPCR analyses

Target name	Sequence (5’- 3’)
GPR65 (Human)	TCACCATCCTGATCTGCAAC
	TTTTCCTTGTTTTCCGTGGC
E-cadherin (Human)	CGAGAGCTACACGTTCACGG
	GGGTGTCGAGGGAAAAATAGG
N-cadherin (Human)	AGCCAACCTTAACTGAGGAGT
	GGCAAGTTGATTGGAGGGATG
Vimentin (Human)	GACGCCATCAACACCGAGTT
	CTTTGTCGTTGGTTAGCTGGT
Snail (Human)	TCGGAAGCCTAACTACAGCGA
	AGATGAGCATTGGCAGCGAG
Twist (Human)	GTCCGCAGTCTTACGAGGAG
	GCTTGAGGGTCTGAATCTTGCT
Zeb1 (Human)	TTACACCTTTGCATACAGAACCC
	TTTACGATTACACCCAGACTGC
Zeb2 (Human)	CAAGAGGCGCAAACAAGCC
	GGTTGGCAATACCGTCATCC

The total RNA in rice tissues is extracted using the TRIzol reagent kit (Vazyme, Nanjing, China). The first-strand cDNA was synthesized from 3 μg total RNA using EasyScript One-Step gDNA Removal and cDNA Synthesis SuperMix Kit (TransGen, Beijing, China). qRT-PCR was performed using the 2×SYBR Green qPCR Mix (SparkJade, Jinan, China), and detection was performed using the Quantstudio™ 7 Flex Real-time PCR system (Applied Biosystems, Carlsbad, CA, USA). The rice Ubiquitin gene (OsUBQ) was used as an internal reference to normalize gene expression. The primer sequences for qRT–PCR are listed in Supplementary Table S1.

Total RNA was extracted and treated with DNaseI using an Ultrapure RNA kit (CWBIO, Taizhou, China), and cDNA was synthesized using a cDNA Synthesis SuperMix kit (TransGen, China) following the manufacturer’s instructions. Gene-specific primers for quantitative real-time RT-PCR (qRT-PCR) analysis were designed using Primer 5.0 (Table S8). BoACTIN-2 was used as internal reference gene. qRT-PCR reaction was performed using 2 × SYBR Green qPCR mix (SparkJade, China) with a QuantStudio TM 3 real-time PCR instrument (Thermo Fisher, Waltham, MA, USA). The PCR reaction was carried out with the following reaction conditions: 94 °C for 30 s; followed by 40 cycles of 94 °C for 5 s, 58 °C for 30 s and 72 °C for 30 s. Samples for qRT-PCR were run in 3 biological replicates with 3 technical replicates, and the data are represented as the mean ± SD (n = 3) for Student’s t-test analysis. The relative gene expression was calculated using the ΔΔCt algorithm, as in our previous study [52 (link)].