Hu6 mcs cmv puromycin

AsPC-1, BxPC-3, Capan-2, Mia PaCa-2, PANC-1, and SW1990 cells were obtained from American Type Culture Collection (ATCC; USA), AsPC-1, BxPC-3, Capan-2, SW1990, and HPDE cell lines were cultured in RPMI 1640 (Gibco, USA), while Mia PaCa-2 and PANC-1 cell lines were grown in DMEM (Gibco, USA). Both medium were supplemented with 10%FBS and 1%Penicillin/Streptomycin. All cell lines were cultured in a humidified atmosphere containing 5%CO2/95% air at 37°C. All the cell lines had been authenticated through STR profiling and confirmed to be mycoplasma-free.
Lipofectamine3000 was purchased from Invitrogen (Invitrogen, USA); 3 small interfering RNAs (siRNA) (st-h-MINDY2-1 GCACAAGCCTCTCCATCAA, st-h-MINDY2-2 GCTGAGCAGTTTCTAAATA, and st-h-MINDY2-3 GTTCGAGTGTTTGAATATA) were provided by RiboBio (China). GeneChem (China) was responsible for designing and manufacturing lentivirus carrying negative control, MINDY2 overexpression vector (Ubi-MCS-3FLAG-SV40-puromycin), MINDY2-encoding short hairpin RNA (shRNA)(hU6-MCS-CMV-Puromycin), and shRNA targeting ACTN4(hU6-MCS-CMV-Puromycin). The directions were strictly followed during every infection or transfection step.

THP-1 cells were obtained from American type culture collection (ATCC, Rockefeller, USA), and RAW264.7 macrophages from the Institute of Life Science Research Center, Shanghai (Chinese Academy of Science, Shanghai, China). Both cell lines were maintained in RPMI Medium 1640 supplemented with 10% fetal bovine serum (FBS) at 37°C in an atmosphere containing 5% CO₂. After 3‒5 days, THP-1 cells were treated with phorbol-12-myristate-13-acetate (PMA, 160 nmol/L; Sigma, St. Louis, USA) for 48 h. The medium was then replaced with a serum-free medium containing ox-LDL (50 μg/ml) for 48 h to transform THP-1 cells to foam cells. For the experiments, cells were infected with control lentivirus (LV-mock, MCS-3FLAG-SV40-puromycin), recombinant lentivirus (LV-EZH2, Ubi- MCS-3FLAG-SV40-puromycin as the vector), and DNMT1 shRNA (human shDNMT1: 5’-GATCCCCCACTGGTTCTGCGCTGGGATTCAAGAGATCCCAGC GCAGAACCAGTGTTTTTGGAAA-3’, mouse shDNMT1: 5’-GATCCCCGAACGG CATCAAGGTGAACTTCAAGAGAGTTCACCTTGATGCCGTTCTTTTTGGAAA-3’, hU6-MCS-CMV-Puromycin as the vector, GeneChem, Shanghai, China) using Polyfect-V-v infection reagent according to manufacturer’s instructions.

The JAK2/STAT3 inhibitor WP1066 was purchased from Selleck Chemicals (Boston, MA, USA). Antibodies for p-JAK, JAK, p-STAT3, STAT3, ATP7A were purchased from Proteintech Group (Wuhan, China). SLC30A7 overexpression plasmids and short hairpin RNA (shRNA) were produced by GV112 vector (hU6-MCS-CMV-Puromycin; GeneChem, China). On the basis of the manufacturer’s recommendation, lentiviral vectors expressing shRNA or scrambled transfected into cells. Steady cell clones transfected with shRNA expressing constructs were chosen with puromycin intervention after infection.