Root samples were frozen in liquid nitrogen and total RNA was extracted using TRI REAGENT (MRC), DNase treated (RQ1 Promega), and reverse transcription was achieved with M-MLV reverse transcriptase (RNase H minus, Point Mutant, Promega) using an anchored oligo(dT)20 primer. Accumulation of transcripts was measured by qRT-PCR (LightCycler 480, Roche Diagnostics) using the SYBRR Premix Ex TaqTM (TaKaRa). Gene expression was normalized using ACT2 as an internal standard. Sequences of primers used in qPCR for gene expression analysis are listed in Supplementary File 1 .
Rnase h minus
Manufactured by Promega
Sourced in United States, Germany
RNase H Minus is a recombinant enzyme that specifically degrades the RNA strand of RNA-DNA hybrids. It lacks the non-specific RNase H activity, allowing for improved reverse transcription and other applications where RNase H activity needs to be minimized.
Automatically generated - may contain errors
Lab products found in correlation
M mlv reverse transcriptase, by Promega (13 mentions)
Point mutant, by Promega (6 mentions)
Random hexamer, by Thermo Fisher Scientific (4 mentions)
Sv total rna isolation system, by Promega (3 mentions)
Ssoadvanced universal sybr green supermix, by Bio-Rad (3 mentions)
Lightcycler 480, by Roche (2 mentions)
Lightcycler faststart dna master sybr green 1 kit, by Roche (2 mentions)
Mirneasy kit, by Qiagen (2 mentions)
Nucleospin rna 2 columns, by Macherey-Nagel (2 mentions)
Oligo dt primer, by Promega (2 mentions)
Point mutant reverse transcriptase, by Promega (2 mentions)
Power sybr green pcr master mix, by Thermo Fisher Scientific (2 mentions)
Abi 7300 real time pcr system, by Thermo Fisher Scientific (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Rq1 rnase free dnase, by Promega (2 mentions)
Rnase inhibitor, by Thermo Fisher Scientific (2 mentions)
Quantstudio 3 real time pcr system, by Thermo Fisher Scientific (2 mentions)
Rox reference dye, by Thermo Fisher Scientific (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Dnase treated, by Promega (1 mentions)
23 protocols using rnase h minus
1
Transcript Quantification via qRT-PCR
2
Quantitative Analysis of IL-2 and IFN-γ Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the T cells by lysis using guanidinium isothiocyanate and phenol acid extraction. A total of 1 µg RNA, 0.5 µl RNase H minus (Promega Corporation) and 1 µl Moloney murine leukemia virus reverse transcriptase were used for cDNA synthesis with the following thermocycling conditions: 95°C 5 min; 95°C 15 sec, 60°C 35 sec, 40 cycles; 72°C 5 min; 4°C terminal. For each PCR, 2 µl cDNA was used and the primers were obtained from BD Biosciences. The primer sequences were as follows: IL-2 forward, 5′-GAATGGAATTAATAATTACAAGAATCCC-3′ and reverse, 5′-TGTTTCAGATCCCTTTAGTTCCAG-3′; and IFN-γ forward, 5′-TCGGTAACTGACTTGAATGTCCA-3′ and reverse, 5′-TCCTTTTTCGCTTCCCTGTTTT-3′. The Light Cycler-Fast Start DNA Master SYBR Green I kit (Roche Diagnostics) was used for the RT-qPCR analysis of IL-2, and the Revert Aid™ First Strand cDNA Synthesis kit (Roche Diagnostics) was used for IFN-γ, according to the manufacturer protocols. The quantitative analysis of original template was performed by the change of fluorescence of the amplification product.
3
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using the Absolutely RNA kit (Stratagene, La Jolla, USA) according to the manufacturer's protocol including a DNase digest. cDNA synthesis was performed using random hexamer primers and M-MLV reverse transcriptase (RNase H minus; Promega, Mannheim, Germany); no template controls (NTCs) and reactions without addition of reverse transcriptase (RT−) served as negative controls. cDNA was quantified by real-time PCR using FAM/TAMRA labeled specific probes (provided by Applied Biosystems, Darmstadt, Germany). Data represent the mean expression level ± standard deviation (standardized to hypoxanthine guanine phosphoribosyltransferase (HPRT) expression) calculated according to the 2−ΔΔCT method of at least three independent measurements per cDNA (technical triplicates).
4
Quantifying Gene Expression in Human Islets
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was reverse transcribed using M-MLV reverse transcriptase, RNAse H minus (Promega). Quantitative PCR was performed using iQ SYBR Green mix and samples were amplified using the CFX Connect Real-time system (Bio-Rad). Islets of human control and T2D patients were homogenized by vortexing in 700 uL Qiazol lysis buffer and the RNA extracted using the miRNeasy kit (Qiagen) with DNase treatment. 100ng total RNA was used for reverse transcription using the High Capacity cDNA kit with RNAse inhibitor (ThermoFisher). For qPCR, PowerUP SYBR Green Master Mix (Applied Biosystems) was used with assay-specific primers (Supplemental Table 1 ).
5
RNA Extraction and Quantitative PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using NucleoSpin RNA II columns (Macherey-Nagel, Hoerdt France) according to the manufacturer’s instructions. cDNA was synthesized by reverse transcription of 1 μg total RNA with M-MLV Reverse Transcriptase, RNase H Minus, Point Mutant reverse transcriptase (Promega, Leiden, The Netherlands) using oligo(dT) primers (Promega). cDNAs were used as template for subsequent quantification by real-time PCR in a reaction mixture containing 1X Power SYBR® Green PCR Master Mix (Applied Biosystems, Halle, Belgium), and 0.1 μM of each primer (sequences available on request). Amplification was performed on an ABI 7300 real-time PCR system (Applied Biosystems). The amount of target gene was normalized to the endogenous level of β-actin using the 2-ΔCT method.
6
Gene Expression Analysis in Hydroponics
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plants were grown in hydroponics to have access to the roots, as previously described in Cassan et al., 2023 (link). Root tissue from 5five plants were pooled into one biological replicate, flash frozen in liquid nitrogen, and stored at –80◦C. RNA were extracted from shoot or root tissues using TRIZOL (Invitrogen, USA), according to the manufacturer recommendations, and DNAse treated using RQ1 (Promega, USA). Reverse transcription was achieved from 1 μg of total RNA with M-MLV reverse transcriptase (RNase H minus, Point Mutant, Promega, USA) using an anchored oligo(dT)20 primer. Accumulation of transcripts was measured by qRT-PCR (LightCycler 480, Roche Diagnostics, USA) using the SYBR Premix Ex TaqTM (TaKaRa, Japan). Gene expression was normalized using UBQ10 and ACT2 as internal standards. Results are presented as the expression relative to UBQ10. Sequences of primers used in RT-qPCR for gene expression analysis are listed in Supplementary file 1F .
7
RNA Extraction and RT-PCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA from aggregates or somatic cells was isolated with the SV Total RNA Isolation System (Promega), RNeasy Mini Kit (Qiagen Inc) or Trizol (Invitrogen), and reverse-transcribed with M-MLV Reverse Transcriptase, RNase H Minus, Point Mutant (Promega) or iScript reverse transcriptase (Bio-Rad). PCR reactions were performed using GoTaq (Promega). Primers used for RT-PCR are listed in Table S1 .
8
Real-Time PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated (n = 5–10 randomly selected from each group, cells n = 8–10) using TRI reagent (Sigma-Aldrich, MO, USA). First-strand cDNA was synthesized using M-MLV Reverse Transcriptase, RNase H Minus, Point Mutant Kit (Promega, WI, USA) [20 (link), 21 (link)]. Pre-optimized TaqMan® probe/primers (Additional file 1 : Table S1, Life Technologies, CA, USA) and SYBR® Green premiers (Additional file 1 : Table S2, Bio-Rad, CA, USA) [22 (link)] were used for the real-time PCR (Eppendorf Realplex2, Hamburg, Germany). The genes of interest were normalized against the housekeeping gene 18s rRNA (Additional file 1 : Table S1). The average value of the control was assigned as the calibrator, against which all other samples are expressed as a fold difference.
9
Quantitative Real-Time PCR Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
According to the manufacturer’s instructions, total RNA was extracted using NucleoSpin RNA II columns (Macherey–Nagel, Hœrdt, France). cDNA was synthesized by reverse transcription of 1 μg total RNA with M-MLV Reverse Transcriptase, RNase H Minus, and Point Mutant reverse transcriptase (Promega, Leiden, The Netherlands) using oligo(dT) primers (Promega). cDNAs were used as a template for subsequent quantification by real-time PCR in a reaction mixture containing 1 × Power SYBR® Green PCR Master Mix (Applied Biosystems, Halle, Belgium) and 0.1 μM of each primer (sequences available on request). Amplification was performed on an ABI 7300 real-time PCR system (Applied Biosystems, Lennik, Belgium). The amount of target gene was normalized to the endogenous level of β-actin using the 2−ΔCT method.
10
Cloning and Expression of Zebrafish flcn
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The full open reading frame for zebrafish flcn was cloned from total RNA extracted from pooled protruding-mouth stage AB* wild type embryos using TRIZOL reagent according to manufacturers’ instructions. Next, cDNA was produced using M-MLV Reverse Transcriptase, RNase H Minus, Point Mutant (Promega M3681, M3682, M3683) and oligodT primers (Invitrogen). Zebrafish flcn cDNA was amplified using the following forward primer with BamHI restriction site: AATA GGATCC ATGAACGCTTTAGTTGCCCTG and reverse primer with Xba1 restriction site: AATA TCTAGA CCCGCTTTCAGTCTCTCTCAC and cloned into pCS2+ using BamHI (New England Biolabs) and XbaI (New England Biolabs). Plasmid was verified by sequence analysis.
Capped RNA was synthesised using 5 μg (5 μl) of NotI linearised flcn DNA using SP6 mMESSAGE mMACHINE kit (Ambion). The RNA was cleaned using GenElute™ Mammalian Total RNA Miniprep Kit (Sigma RTN70) as per manufacturer’s instructions Appendix 2.
Capped RNA was synthesised using 5 μg (5 μl) of NotI linearised flcn DNA using SP6 mMESSAGE mMACHINE kit (Ambion). The RNA was cleaned using GenElute™ Mammalian Total RNA Miniprep Kit (Sigma RTN70) as per manufacturer’s instructions Appendix 2.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!