Primers (LabPathITS1-3F: 5'-CAA CTC AAT GAA TAT CTT GGT TTC C-3', and LabPathITS1-3R: 5’-CCG CTT ATT GAT ATG CTT AAA TTC-3') targeted the ITS region of the ribosomal RNA gene complex (Duffin et al., 2020 (link)). Quantitative PCR (qPCR) reactions were prepared with the following final concentrations: 1 ng μl−1 of DNA template, 0.025μM of each primer, 2.7 ng μl−1 of BSA, 1X of iTaq SYBR Green Supermix (Bio-Rad Laboratories, Hercules, CA, United States), and nuclease free water up to 20 μl. Reactions were run in triplicate on a CFX Connect thermal cycler (Bio-Rad) with the following cycle parameters: 5min at 95°C, followed by 45 rounds of 30 s at 95°C and 60 s at 63°C. Reactions were terminated with a melting curve analysis (65–95°C, at 0.5°C increments). Results are reported as the number of Labyrinthula spp. cells per mg starting seagrass tissue (dry weight, ~5 mg). See Duffin et al. (2020) (link) for additional details.
Cfx connect thermal cycler
Manufactured by Bio-Rad
Sourced in United Kingdom, United States, Spain
The CFX Connect thermal cycler is a compact and versatile instrument designed for real-time PCR (polymerase chain reaction) applications. It features a high-resolution, full-color LCD touch screen interface and a 96-well sample block that supports a wide range of sample volumes. The CFX Connect is capable of performing sensitive and accurate DNA amplification and analysis.
Automatically generated - may contain errors
Lab products found in correlation
Nanodrop spectrophotometer, by Thermo Fisher Scientific (6 mentions)
Nanodrop, by Thermo Fisher Scientific (6 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (6 mentions)
Purelink rna mini kit, by Thermo Fisher Scientific (4 mentions)
Power sybr green pcr master mix, by Thermo Fisher Scientific (4 mentions)
Hot firepol evagreen qpcr supermix, by Solis BioDyne (4 mentions)
Rneasy kit, by Qiagen (4 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (4 mentions)
Revertaid h minus first strand cdna synthesis kit, by Thermo Fisher Scientific (4 mentions)
Superscript vilo cdna synthesis kit, by Thermo Fisher Scientific (3 mentions)
Ssoadvanced universal sybr green supermix, by Bio-Rad (3 mentions)
Chamq sybr qpcr master mix, by Vazyme (2 mentions)
Powerup sybr master mix, by Thermo Fisher Scientific (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Dnase 1, by Thermo Fisher Scientific (2 mentions)
Nucleospin rna isolation kit, by Macherey-Nagel (2 mentions)
Fragment analyzer, by Agilent Technologies (2 mentions)
S220 focused ultrasonicator, by Covaris (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
M mlv reverse transcriptase, by Thermo Fisher Scientific (2 mentions)
36 protocols using cfx connect thermal cycler
1
Quantitative PCR for Labyrinthula spp. Detection
2
Real-Time PCR Analysis of MCP-1 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A Pure Link RNA Mini kit (Invitrogen, Carlsbad, CA, USA) was used for the extraction of total RNA from HUVECs, and cDNA was synthesized with a Superscript VILO cDNA Synthesis kit (Invitrogen, Carlsbad, CA, USA). Real-time PCR was performed using Power SYBR Green PCR Master Mix (Applied Biosystems, Warrington, UK) on a CFX connect thermal cycler (Bio-Rad, Hercules, CA, USA). The value of each cDNA was calculated using the ΔΔCq method and normalized to the value of the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH).
Oligonucleotide PCR primers targeting MCP-1 mRNA were designed according to a previous report [44 (link)], and the specificity of the primers was confirmed by BLAST search and melting curve analysis. The primer sequences are shown inTable 1 .
The reaction conditions were as follows: activation step at 95 °C for 10 min, followed by 40 cycles of denaturation at 95 °C for 15 s and annealing/extension at 60 °C for 1 min.
Oligonucleotide PCR primers targeting MCP-1 mRNA were designed according to a previous report [44 (link)], and the specificity of the primers was confirmed by BLAST search and melting curve analysis. The primer sequences are shown in
The reaction conditions were as follows: activation step at 95 °C for 10 min, followed by 40 cycles of denaturation at 95 °C for 15 s and annealing/extension at 60 °C for 1 min.
3
SYBR Green qPCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The PCR reactions were carried out in a final volume of 20 μL, containing 100 nM of each primer and 2 μL of cDNA (synthetized in the previous step) in iQ™ SYBR® Green Supermix (Bio-Rad, Madrid, Spain). Following an initial 3 min denaturation/activation step at 95 °C, the mixture was subjected to 45 cycles of amplification (denaturation for 15 s at 95 °C; annealing and extension for 15 s at 58 °C) in a CFX Connect™ Thermal Cycler (Bio-Rad, Madrid, Spain). The generation of PCR products was monitored after each extension step at 58 °C by measuring the fluorescence of double-stranded DNA binding SYBR Green dye. In order to determine the melting temperatures of the amplified products after SYBR Green qPCR, the temperature was raised from 55 °C to 95 °C and the fluorescence was detected for 10 s after each 0.2 °C. From each reaction, the threshold cycle value (Ct) was established as the cycle number at which fluorescence was detectable over the threshold value calculated by the iCycler iQ™ software (Bio-Rad, Madrid, Spain) for cycles 2–10.
4
Quantitative Real-Time PCR Analysis of Early Embryonic Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from the early embryos as described above. cDNA was then synthesized using HiScript II Q Select RT SuperMix for qPCR with gDNA wiper (Vazyme #R233-01) according to the manufacturer’s instructions. Real-time PCR was performed on a CFX Connect Thermal Cycler (Bio-Rad) with ChamQ SYBR qPCR Master Mix (Vazyme # Q311-02). Amplification was performed with a two-step reaction at 95°C for 3 min and 40 cycles at 95°C for 15 s and at 60°C for 30 s. A 20 μL PCR mixture included 10 μL ChamQ SYBR qPCR Master Mix, 2 μL primer mix (10 μM each), 3 μL diluted template cDNA, and 5 μL deionized distilled water. The relative fold changes in related genes were normalized to expression levels of actin, and analyzed by 2-way ANOVA followed by Dunnett’s multiple comparisons. Each experiment was repeated four times. The PCR primers used in this study are listed in Supplementary Table 2 .
5
MYCN-driven ODC1 gene expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SH-EP MYCN-ER cells were used as previously described (37 (link)). Cells were cultured in the presence or absence of 300 nM of 4-hydroxytamoxifen (4-OHT). Total RNA was extracted using Direct-zol RNA Kit (R2051, Zymo Research, Freiburg, Germany) according to the manufacturer’s instructions and reverse-transcribed using SuperScipt III (18080-51, Invitrogen, Darmstadt, Germany). Gene expression of ODC1 was determined by quantitative real-time PCR 48 h after activation of MYCN using forward primer GCATGTGGTGATTGGATGGTGTT, reverse primer TGGCTCTGGATCTGCCTTCATGAGT, and Advanced Universal SYBER Green Supermix (1725274, Bio-Rad, Feldkirchen, Germany) in a CFX Connect Thermal Cycler (Bio-Rad).
6
Quantitative RT-PCR Analysis of Adiponectin Receptors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cellular RNA was isolated using RNeasy Kit according to the manufacturer’s instructions (Qiagen) and quantified using a NanoDrop spectrophotometer (ND-1000; Thermo Scientific). cDNA was obtained using a High Capacity cDNA Reverse Transcription Kit (Applied Biosystem) with random hexamers. qPCR were performed with a CFX Connect thermal cycler (Bio Rad) using Hot FIREpol EvaGreen qPCR SuperMix (Solis Biodyne) and standard primers. Samples were measured as triplicates. The relative expression of each gene was calculated according to the ΔΔCT method [64 (link)]. Expression of the housekeeping gene PPIA was used to normalize for variations in RNA input. Primers used were: AdipoR1-For (CCATCTGCTTGGTTTCGTGC) and -Rev (AGACGGTGTGAAAGAGCCAG), AdipoR2-For (TCATCTGTGTGCTGGGCATT) and -Rev (CTATCTGCCCTATGGTGGCG), GAPDH-For (GAGAAGGCTGGGGCTCATTT) and -Rev (TAAGCAGTTGGTGGTGCAGG), PPIA-For (GTCTCCTTTGAGCTGTTTGCAG) and -Rev (GGACAAGATGCCAGGACCC), and SCD-For (TTCGTTGCCACTTTCTTGCG) and -Rev (TGGTGGTAGTTGTGGAAGCC).
7
Real-Time PCR Analysis of MCP-1 in HUVECs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from HUVECs using the Pure Link RNA Mini Kit (Invitrogen, Carlsbad, CA, USA). The cDNA was synthesized using the Superscript VILO cDNA Synthesis kit (Invitrogen, Carlsbad, CA, USA). Real-time PCR using Power SYBR Green PCR Master Mix (Applied Biosystems, Warrington, UK) was carried out on a CFX connect thermal cycler (Bio-Rad, Hercules, CA, USA). The value of each cDNA was calculated using the ΔΔCq method and normalized to the value of the housekeeping gene GAPDH.
Oligonucleotide PCR primers targeting human MCP-1 mRNA were designed according to a previous report [37 (link)] and primers targeting human GAPDH mRNA were purchased from TaKaRa (Shiga, Japan); the specificity of the primer sets was verified by a basic local alignment search tool (BLAST) search and melting-curve analysis. The primer sequences and accession numbers are shown inTable 1 . The reaction conditions were as follows: an activation step at 95 °C for 10 min, followed by 40 cycles of denaturation at 95 °C for 15 s and annealing/extension at 60 °C for 1 min.
Oligonucleotide PCR primers targeting human MCP-1 mRNA were designed according to a previous report [37 (link)] and primers targeting human GAPDH mRNA were purchased from TaKaRa (Shiga, Japan); the specificity of the primer sets was verified by a basic local alignment search tool (BLAST) search and melting-curve analysis. The primer sequences and accession numbers are shown in
8
Gene Expression Analysis in Mouse Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated from the hypothalamus and visceral adipose tissue (vWAT) of 30–34-week-old mice. Mice were sacrificed, the brain was removed, dissected, and both tissues immediately frozen in liquid nitrogen. RNA isolation from hypothalamus was performed using TRI-Reagent (Sigma-Aldrich) according to the manufacturer’s instructions. Adipose tissue RNA was isolated using the SV Total RNA Isolation System (Promega). RNA was transcribed into cDNA by reverse transcription using Superscript II Reverse Transcriptase (ThermoFisher) and a mixture of oligo (dT) and random hexamer primers according to the manufacturer’s protocol. mRNA expression of genes was determined by qPCR with specific primers (supplementary Table S1 ) for the respective genes using the Luna Universal qPCR Master Mix (New England BioLabs) according to manufacturer’s protocol and the CFX Connect Thermal Cycler (BioRad). For primer sequences, see supplementary Table S1 . Data analysis was performed with the CFX Manager (Bio-Rad).
9
Quantifying Fly Gene Expression via qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
7 to 10-day-old male flies entrained to 12:12 LD were frozen at -80ºC and heads were separated by vortexing and collected on ice. RNA was extracted from 30 fly heads for each of 4 biological replicates per genotype with TRIzol (Invitrogen) following the manufacturer’s protocol. Samples were treated with DNaseI (Invitrogen), then heat inactivated. cDNA was synthesized by Revertaid First Strand cDNA Synthesis Kit (Thermo Scientific). PowerUp SYBR Mastermix (Applied Biosystems) was used to perform qRT-PCR using a CFXConnect thermal cycler (BioRad). Primer efficiency and relative quantification of transcripts were determined using a standard curve of serial diluted cDNA. Transcripts were normalized using ribosomal protein S3 (RPS3) as a reference gene.
Primer sequences:
Cul3-fwd-ATGCTACTTTTGTCGCCCATCGC
Cul3-rev-CTGGGTTATCCTTGGTTTATCCTGGCCT
RPS3-fwd-CGAACCTTCCGATTTCCAAGAAACGC
RPS3-rev-ACGACGGACGGCCAGTCCTCC
Primer sequences:
Cul3-fwd-ATGCTACTTTTGTCGCCCATCGC
Cul3-rev-CTGGGTTATCCTTGGTTTATCCTGGCCT
RPS3-fwd-CGAACCTTCCGATTTCCAAGAAACGC
RPS3-rev-ACGACGGACGGCCAGTCCTCC
10
Macrophage Transcriptome Analysis Pipeline
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!