Te buffer

Manufactured by Sangon

Sourced in China

TE buffer is a commonly used solution in molecular biology and biochemistry laboratories. It is a buffer solution consisting of Tris-HCl and EDTA, which is used to maintain the pH and chelate divalent cations, respectively. TE buffer is primarily used for the storage and dilution of DNA, RNA, and other nucleic acid samples.

Automatically generated - may contain errors

Lab products found in correlation

Klenow fragment 3 5 exo polymerase kf polymerase, by New England Biolabs (2 mentions) 20 bp dna ladder dye plus, by Takara Bio (2 mentions) Tae buffer, by Sangon (2 mentions) Sanprep column dna gel extraction kit, by Sangon (2 mentions) Agarose, by Sangon (2 mentions) 6 mercapto 1 hexanol, by Merck Group (1 mentions) Tris 2 carboxyethyl phosphine hydrochloride, by Merck Group (1 mentions) Mag mk virus rna extraction kit, by Sangon (1 mentions) Water purification system, by Merck Group (1 mentions) Ammonium persulfate aps, by Sangon (1 mentions) Dna loading buffer, by Sangon (1 mentions) Hplc purified oligonucleotides, by Sangon (1 mentions) Goldview, by Solarbio (1 mentions) Syto rnaselect, by Thermo Fisher Scientific (1 mentions) Sodium arsenite, by Merck Group (1 mentions) Baker s yeast rna, by Merck Group (1 mentions) Rnase a, by Thermo Fisher Scientific (1 mentions) Dnase 1, by Thermo Fisher Scientific (1 mentions) 4 6 diamidino 2 phenylindole (dapi), by Merck Group (1 mentions) Hoechst 33342, by Merck Group (1 mentions)

8 protocols using te buffer

Purification and Characterization of Oligonucleotides

Check if the same lab product or an alternative is used in the 5 most similar protocols

HPLC-purified oligonucleotides used in this research (as listed in Table S1) were supplied by Sangon Biotech Inc. (Shanghai, China) and fully dissolved in an ice box with 1 × TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) at a storage concentration of 10 μM.
The 1 × TE buffer, 10 mM deoxynucleotide triphosphates (dNTPs), 6 × DNA loading buffer, 30% acrylamide/bis solution, and ammonium persulfate (APS) were obtained from Sangon Biotechnology Co. Ltd (Shanghai, China).
N,N,N′,N′-Tetramethylethylenediamine (TEMED) and 20 bp DNA Ladder (Dye Plus) used for polyacrylamide gel electrophoresis was acquired from TaKaRa Biotech (Dalian, China). GoldView was acquired from Solarbio LIFE SCIENCES (Beijing, China). ThT was purchased from BBI LIFE SCIENCES CORPORATION (Shanghai, China) and dissolved in ultrapure water to 100 μM for fluorescent measurements. Nb.BbvCI endonuclease and Klenow fragment (3′-5′ exo-) polymerase (KF polymerase) used in this study were provided by New England Biolabs (Beijing, China). Ultrapure water used for solution preparation was obtained from a Millipore water purification system with a resistivity of 18.2 MΩ cm. Human serum samples for the recovery experiment were obtained from the First Affiliated Hospital of Chongqing Medical University.

Yi G., Duan Q., Yan Q., Huang Y., Zhang W, & Zhao S. (2021). Polymerase/Nicking Enzyme Powered Dual-template Multi-cycle G-Triplex Machine for HIV-1 Determination. Analytical sciences : the international journal of the Japan Society for Analytical Chemistry, 37(8).

+ Open protocol

+ Expand

SARS-CoV-2 Detection Protocol with Inactivated Strains

Check if the same lab product or an alternative is used in the 5 most similar protocols

Tris (2-carboxyethyl) phosphine hydrochloride (TCEP, 98.0%) and 6-Mercapto-1-hexanol (MCH, 98.0%) were purchased from Sigma-Aldrich. The fluorescence ERA (No. KS103) and RT-ERA (No. ZK009) reaction kits were purchased from GenDx Biotech (Suzhou, China). The Mag-MK Virus RNA Extraction Kit (NO. B518767), magnetic separation device (NO. B518800), One-Step RT-qPCR Probe Kit (NO. B639278), DEPC-treated water (DEPC, NO. B501005), 1 × TE buffer (NO. B548106), and RNase inhibitor (RNaseI) (NO. B600478) were purchased from Sangon Biotech (Shanghai, China). Nuclease-free water was purchased from TINGEN (RT-121, Beijing, China). SARS-CoV-2 RNA standard (No.H2101262/004) was purchased from SIMT (Shanghai, China). SARS-CoV-2 β-inactivated virus strain (ZK009) and γ-inactivated virus strain (ZK009), human SARS, and human influenza A viruses (H1N1, H3N2, H5N1, and H7N9 subtypes) were purchased from Bio come (Nanjing, China). Conventional primer, thiolated primer, fluorescence resonance energy transfer (FRET) probe, and plasmid DNA (orf1ab and N gene) associated with the SARS-CoV-2 virus were synthesized by Sangon Biotech (Shanghai, China).

Liu J., Chen P., Hu X., Huang L., Geng Z., Xu H., Hu W., Wang L., Wu P, & Liu G.L. (2022). An ultra-sensitive and specific nanoplasmonic-enhanced isothermal amplification platform for the ultrafast point-of-care testing of SARS-CoV-2. Chemical Engineering Journal, 451, 138822.

+ Open protocol

+ Expand

Genotyping Conditional Knockout Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols

The Cdyl cKO mice were identified by genotyping. DNA was prepared from 3 mm of clipped tail specimen from mice and extracted in 50 µL of DNA lysis buffer containing 0.1 mg mL⁻¹ proteinase K by incubation in 55 °C for 4–6 h. Then 200 µL TE buffer (B548106, Sangon Biotech) was added to the samples and the temperature was raised to 95 °C for 10 min to inactivate proteinase K. The mouse genotype was identified by PCR on the genomic DNA with 35 cycles of 95 °C for 40 s, 58 °C for 30 s, and 72 °C for 40 s. The primers for Cdyl^F/F mice were: flox forward, 5′‐ACTGATGTCTTAAGATAAGGTCCTTCTG‐3′ and flox reverse, 5′‐TGCAATGAGCTCAAACTACATGCC‐3′. The primers for Nav1.8‐Cre and Prrxl1‐CreER^T2 mice were: Cre forward, 5′‐GCCTGGCATTACCGGTCGATGC‐3′ and Cre reverse, 5′‐TGCAATGAGCTCAAACTACATGCC‐3′.

Sun Z., Waybright J.M., Beldar S., Chen L., Foley C.A., Norris‐Drouin J.L., Lyu T., Dong A., Min J., Wang Y., James L.I, & Wang Y. (2022). Cdyl Deficiency Brakes Neuronal Excitability and Nociception through Promoting Kcnb1 Transcription in Peripheral Sensory Neurons. Advanced Science, 9(10), 2104317.

+ Open protocol

+ Expand

HeLa Cell Culture and Reagent Preparation

Check if the same lab product or an alternative is used in the 5 most similar protocols

SYTO RNASelect (Thermo Fisher Scientific, S32703) was purchased from Thermo Fisher (Waltham, MA, USA). Salmon testes DNA (Sigma, D1626) and baker’s yeast RNA (Sigma, R6750) were purchased from Sigma (Saint Louis, MO, USA). RNase A and DNase I were purchased from Ambion (Austin, TX, USA). Hoechst 33,342 and DAPI were purchased from Sigma (Saint Louis, MO, USA). Sodium arsenite was purchased from Sigma (Saint Louis, MO, USA). TE buffer was purchased from Sangon Biotech (Shanghai, China). The HeLa cells used in this study were obtained from the cell bank of Sun Yat-Sen University Experimental Animal Center (Guangzhou, China).

Fang L., Shao W., Zeng S.T., Tang G.X., Yan J.T., Chen S.B., Huang Z.S., Tan J.H, & Chen X.C. (2022). Development of a Highly Selective and Sensitive Fluorescent Probe for Imaging RNA Dynamics in Live Cells. Molecules, 27(20), 6927.

+ Open protocol

+ Expand

Authenticating Citri Reticulatae Pericarpium Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols

A total of 22 Citri Reticulatae Pericarpium samples were collected from Guangdong, Chongqing, and Guangxi provinces Table 1. They were authenticated by Dr. Lin Jiang, Sun Yat-Sen University, China. Cetyltrimethylammonium bromide (CTAB), NaCl, EDTA, chloroform, isopropanol, isoamyl, mercaptoethanol, and methanol were of analytical grade and manufactured by Tianjin Zhiyuan Chemical Reagent Factory (Tianjin, China). PVP-40, Tris-HCl (pH 8.0), TE buffer, TAE buffer, agarose, Taq PCR Master Mix (2×, blue dye), and SanPrep Column DNA Gel Extraction Kit were purchased from Sangon Biotech (Shanghai). Goldview (MYM Biological Technology Co., Ltd. USA) was used for agarose examination. Acetonitrile was of HPLC grade manufactured by SK Chemicals (Korea). Ultrapure water was obtained from a Milli-QRG purification unit (Millipore, Bedford, MA, USA).

Yu X., Zhang Y., Wang D., Jiang L, & Xu X. (2018). Identification of Three Kinds of Citri Reticulatae Pericarpium Based on Deoxyribonucleic Acid Barcoding and High-performance Liquid Chromatography-diode Array Detection-electrospray Ionization/Mass Spectrometry/Mass Spectrometry Combined with Chemometric Analysis. Pharmacognosy Magazine, 14(53), 64-69.

+ Open protocol

+ Expand

DNA Extraction of Dian-Jixueteng and Jixueteng

Check if the same lab product or an alternative is used in the 5 most similar protocols

A total of nine commodity samples retailed as Dian-Jixueteng and Jixueteng were purchased from different pharmacies in Yunnan and Guangdong provinces [Table 1]. Cetyltrimethylammonium bromide (CTAB), NaCl, ethylenediaminetetraacetic acid (EDTA), chloroform, isopropanol, isoamyl, and mercaptoethanol were analytical grade and manufactured by Tianjin Zhiyuan Chemical Reagent Factory (Tianjin, China). Polyvinylpyrrolidone (PVP), Tris-HCl buffer (pH 8.0), TE buffer, TAE buffer, agarose, Taq PCR Master Mix (×2, blue dye), and SanPrep Column DNA Gel Extraction Kit were purchased from Sangon Biotech (Shanghai, China). Goldview (MYM Biological Technology Co., Ltd., USA) was used for agarose gel electrophoresis.

Yu X., Xie Z., Wu J., Tao J, & Xu X. (2016). DNA Barcoding Identification of Kadsurae Caulis and Spatholobi Caulis Based on Internal Transcribed Spacer 2 Region and Secondary Structure Prediction. Pharmacognosy Magazine, 12(Suppl 2), S165-S169.

+ Open protocol

+ Expand

Optimized Nicking Endonuclease-Mediated DNA Amplification

Check if the same lab product or an alternative is used in the 5 most similar protocols

The Nb.BbvCI nicking endonuclease and Klenow fragment (3′–5′ exo-) polymerase (KF polymerase) were acquired from New England Biolabs (Beijing, China). TE buffer (10 mM Tris–HCl, 1 mM EDTA, pH 8.0), deoxynucleotides (dNTPs), 6× loading buffer, acryl/bis 30% solution (29 : 1), ammonium persulfate and N,N,N′,N′-tetramethylethylenediamine (TEMED) were purchased from Sangon Biotechnology Co. Ltd (Shanghai, China). Thioflavin T (ThT) was acquired from Sigma-Aldrich (St. Louis, USA). GoldView I was purchased from SBS Genetech (Beijing, China). The 20-bp DNA Ladder (Dye Plus) was purchased from TaKaRa Biotech (Dalian, China). Human serum was from the First Affiliated Hospital of Chongqing Medical University. All oligonucleotides used in this study were synthesized by Sangon Biotech Inc. (Shanghai, China), and the detailed oligonucleotide sequences are listed in Table S1.† During the design of P-HP, the website https://sg.idtdna.com/calc/analyzer was employed to predict the secondary structure. Ultrapure water obtained from a Millipore water purification system (18.2 MΩ, Milli-Q, Millipore) was used to prepare all the solutions in this experiment.

Yan Q., Duan Q., Huang Y., Guo J., Zhong L., Wang H, & Yi G. (2019). Symmetric exponential amplification reaction-based DNA nanomachine for the fluorescent detection of nucleic acids. RSC Advances, 9(70), 41305-41310.

+ Open protocol

+ Expand

Colorimetric Bioassay for Streptavidin Detection

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA oligonucleotides were synthesized and purified by Sangon Inc. (Shanghai, China). Their sequences are listed in Table 1. Streptavidin, bovine serum albumin (BSA), SYBR Green I (SG I), TMB, citric acid, disodium hydrogen phosphate, TE buffer, 0.1 M PBS buffer, 2 × SSC hybridization buffer and transparent ELISA plate were also purchased from Sangon Inc. (Shanghai, China). Colorimetric bioassay was carried out on a PHOMO Automatic enzyme immunoassay analyzer (Zhengzhou Antu Instruments Co. Ltd., China)Table 1

Oligonucleotides used in the present work.

Oligonucleotides	Sequences (5′-3′)
SA aptamer:	TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC
Capture probe:	bio-TTTTTGTTGTAGCAC
detection probe P1:	CTCATGGAGAGAGAATTTGGGTGCGAGACGTGCTACAA
detection probe P2:	CAGCGATCAGTTCAACTCTCTCCATGAG
detection probe P3:	GTCTCGCACCCAAAGAACTGATCGCTG

Yu T., Xu H., Zhao Y., Han Y., Zhang Y., Zhang J., Xu C., Wang W., Guo Q, & Ge J. (2020). Aptamer based high throughput colorimetric biosensor for detection of staphylococcus aureus. Scientific Reports, 10, 9190.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!