Pyromark gold q96 reagent kit

Genomic DNA was extracted from 2 ml of whole blood in ethylenediaminetetraacetic acid (EDTA) tubes using the QIAamp DNA Blood Midi Kit (Qiagen, Hilden, Germany). DNA concentration was measured using the Qubit Flourometer (Invitrogen, Carlsbad, USA) with the Quanti-iT dsDNA Broad Range assay kit (ThermoFisher, Massachusetts, USA), according to the manufacturer’s instructions. DNA methylation analysis was performed using pyrosequencing. Briefly, 500 ng of DNA was bisulfite converted using the EpiTech Fast DNA Bisulfite Kit (Qiagen, Hilden, Germany), according to the manufacturer’s instructions. PCR was performed on 20 ng of bisulfite converted DNA using the Pyromark PCR kit and pyrosequencing was conducted using the PyroMark Gold Q96 reagent kit and the PyroMark Q96 pyrosequencer (Qiagen). Bisulfite treatment and pyrosequencing assays were tested using bisulfite conversion controls and methylated standards (0% to 100%) (S1 Fig) (Qiagen), according to manufacturer’s instructions. Samples were randomly selected and tested in duplicate to confirm reproducibility of methylation data.

Pyrosequencing was performed using a PyroMark Q24 sequencer (Qiagen) with a PyroMark Gold Q96 Reagent Kit (Qiagen) according to the manufacturer's protocol. A mean methylation index was calculated from the CpG site methylation percentages for each gene. The results were analyzed using default software settings. We considered 0–5% unmethylated (hypomethylated), and values above 5% were considered methylated (hypermethylated)^{22 (link)}. The pyrosequencing primers are available upon request.

Two subsets of CpGs within or close to the ITGA9-promoter region sequenced from the clones (above; Figure 4) were used for pyrosequencing after bisulfite-conversion. For pyrosequencing DNAs from same set of NPC tissue and NNE samples were used as in the sequencing of clones. They included five NPC tumors and two control nasopharyngeal epithelial biopsies. The bisulfite pyrosequencing was performed according to the Pyrosequencing Assay Design Software v2.0 (QIAGEN), details of employed sequences are provided in Table 2. Two μl of bisulfite modified genomic DNA (∼20 ng) was used as a template in PCRs performed with the PyroMark PCR kit (QIAGEN, Cat#: 978703) following the manufacturer's recommendations. A melting temperature of 58°C was used for both the assays. PCR amplifications were performed in 50 μl volumes. The entire PCR product, 4 μM of the respective sequencing primer and 2 μl of streptavidin sepharose high-performance beads (GE Healthcare, Cat#: 17-113-01), were used for bisulfite pyrosequencing performed with the PSQ 96 ID system with enzymes and substrates from the PyroMark Gold Q96 reagent kit (QIAGEN, Cat#: 972804). PyroMark Q96 ID software 2.5.8.15 (QIAGEN) was used for data analysis.

An epigenetic analysis was performed by bisulfite pyrosequencing, which is a sensitive and accurate method for the detection of methylation. DNA was treated with sodium bisulfite using the EpiTect Bisulfite Kit (Qiagen), which was followed by the cleanup of bisulfite-converted DNA. PCR amplification was then performed with a PyroMark CpG Assay Kit (Qiagen) and a PyroMark Gold Q96 Reagent Kit (Qiagen) in a PyroMark Q96 system (Biotage AB, Uppsala Sweden). PyroMark PCR master mix includes HotStarTaq DNA polymerase and optimized PyroMark reaction buffer that contains 3 mM MgCl2 and dNTPs, 10x CoralLoad Concentrate, 5x Q-Solution, 25 mM MgCl2, and RNase-free water. The PCR amplicon covers the sequence of human chomosome 3q: NC_000003.12 (179148114.179240084). Nine CpG sites are located in the promoter region of the PIK3CA gene (-100 bps) as indicated with the bold letter ‘C’ and recorded as CpG1-9 (Figure 6A). Finally, the methylation levels of these CpG sites were detected with a PyroMark Gold 96 Reagent Kit (Qiagen) and a PyroMark Q96 ID pyrosequencing system (Biotage). The unmethylated and unconverted DNA samples (Qiagen) were used to control the conversion efficiency during the bisulfite treatment and the accuracy of the methylation analyses. PyroQ-CpG software (Biotage) was used for methylation data analysis.

Once the mutation has been identified, a SNP-based genotyping test has been developed to distinguish 129S2/SvPas A/A “mutant” and 129S2/SvPas G/G mice bred in Pasteur institute. DNA was extracted from tail biopsies: proteinase K (20 mg/ml, Invitrogen) digestion at 56°C for 2 h, followed by heat inactivation at 95°C for 10 min. Genotyping was performed by pyrosequencing on a Pyroseq PSQ96MA (Biotage/QIAGEN). Pyrosequencing was centered on the SNP [G/A] in position 1232. Primers used were as follow:
Forward-5′- GTTTGCCAACTCTTCCAGGTTC;
Reverse-biotinylated-5′-GCCATAGTACATCATGGTCCTCTC;
Sequencing-5′- CAGGTTCATGGGGGC.
PCR amplifications were carried out with forward and reverse-biotinylated primers using 5 µl genomic DNA (3 min at 95°C, followed by 50 cycles of 15 sec at 95°C, 30 sec at 60°C, 30 sec at 72°C and 5 min at 72°C). Amplified fragments were captured with Streptavidin Sepharose beads (GE HealthCare) and sequenced with sequencing primer using the PyroMark Gold Q96 Reagent Kit (QIAGEN).

Bisulfite pyrosequencing was performed for technical validation. Primers were designed using PyroMark Design software (Qiagen), and sequences are presented in Supplementary Table 3. Three DMPs; cg05575921 (AHRR), cg21566642 (ALPPL2) and cg06126421 (IER3/DDR1), including additional adjacent CpGs (see Supplementary Figure 1), were selected for validation from the S cohort. Genomic DNA (500 ng) was treated with sodium bisulfite (Methylation gold Bisulfite Kit, Zymo) and subsequently 1 µl of converted DNA (~10 ng) was applied as template in the PCRs performed with the PyroMark PCR Kit (Qiagen). The entire PCR product and 4 pmol of the respective sequencing primer, and streptavidin sepharose high performance beads (GE Healthcare), were used for pyro-sequencing performed with the PSQ 96 system and the PyroMark Gold Q96 Reagent Kit (Qiagen). The PyroMark CpG software 1.0.11 served for data analysis.