For the AU ALS datasets, bisulfite conversions were performed in 96-well plates using the EZ-96 DNA Methylation Kit (Zymo Research, Irvine, CA, USA). Prior to conversion, DNA concentrations were determined by the Take3™ Micro-Volume Plate on the Epoch™ Microplate Spectrophotometer (BioTek Instruments, Inc.) and standardized to include 500 ng. Three technical replicates were included in each conversion to assess repeatability. The following DNA samples were obtained from the NIGMS Human Genetic Cell Repository at the Coriell Institute for Medical Research: CEPH NA06997 and CEPH NA07029. Each DNA sample was included as a control on alternating plates. One sample from each run was duplicated on the plate and one sample duplicated from a different plate. DNA recovery after conversion was quantified using the Take3™ Micro-Volume Plate on the Epoch™ Microplate Spectrophotometer (BioTek Instruments, Inc.). Samples that showed incomplete bisulfite conversion (calculated concentration <25 ng/μl) were not taken forward to the assessment of DNA methylation. Bisulfite converted DNA samples were hybridized to the 12 sample, Illumina Infinium HumanMethylation450 Beadchip (Illumina Inc., San Diego, CA) using the Infinium HD Methylation protocol and Tecan robotics. DNAm data for the NL sample were generated under similar protocols.
Take3 micro volume plate
Manufactured by Agilent Technologies
Sourced in United States, Germany
The Take3 Micro-Volume Plate is a lab equipment product designed for sample measurement. It enables the analysis of small-volume samples with high accuracy.
Automatically generated - may contain errors
Lab products found in correlation
Epoch microplate spectrophotometer, by Agilent Technologies (18 mentions)
Endofree plasmid mega kit, by Qiagen (9 mentions)
Synergy htx multi mode microplate reader, by Agilent Technologies (8 mentions)
Rneasy mini kit, by Qiagen (7 mentions)
Trizol reagent, by Thermo Fisher Scientific (6 mentions)
Powerup sybr green master mix, by Thermo Fisher Scientific (5 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (5 mentions)
Invitrap spin universal rna mini kit, by Stratec (5 mentions)
Iscript cdna synthesis kit, by Bio-Rad (5 mentions)
Trizol, by Thermo Fisher Scientific (4 mentions)
Tri reagent, by Merck Group (4 mentions)
Itaq universal sybr green supermix, by Bio-Rad (4 mentions)
Quantitect reverse transcription kit, by Qiagen (3 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (3 mentions)
Epoch spectrophotometer, by Agilent Technologies (3 mentions)
Cfx96 touch real time pcr detection system, by Bio-Rad (3 mentions)
Goscript reverse transcriptase, by Promega (3 mentions)
Mirneasy kit, by Qiagen (2 mentions)
Rneasy kit, by Qiagen (2 mentions)
Gen5 microplate reader, by Agilent Technologies (2 mentions)
95 protocols using take3 micro volume plate
1
High-Throughput DNA Methylation Profiling
2
Quantifying Circulating miRNAs from Serum Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA (including small RNA) was extracted from the serum using a NucleoSpin miRNA Plasma kit (Macherey-Nagel, Frankfurt, Germany). The RNA concentration was determined using the Synergy™ HTX Multi-Mode Microplate Reader using Take3 Micro-Volume Plates (BioTek Instruments Inc., Winooski, VT, USA).
The quantification of miRNAs was carried out using the SYBR Green Real-Time (RT) polymerase chain reaction (PCR) (Thermo-Fisher Scientific, Waltham, MA, USA). Briefly, 1 ng of template RNA was reverse transcribed (in 20 µL) using a stem-loop primer. For the PCR reaction, 1 µL of RT product was used. The PCR was carried out using the Magnetic Induction Cycler PCR detection system (Bio Molecular Systems, Upper Coomera, Australia). Both the RT and PCR reactions were performed in triplicate, in 3 separate experiments. The analysed miRNAs were considered as present when the threshold cycle values were lower than 30. The U6 snRNA was used as the house-keeping gene. The primers for U6 snRNA were forward, GCT TCG GCA CAT ATA CTA AAA T, and reverse, CGC TTC ACG AAT TTG CGT GTC AT. The forward- and reverse-transcribed primers for the different miRNAs are listed inTable 5 . The common reverse primer for the PCR of the miRNAs was GTG CGT GTC GTG GAG TC.
There were no differences in the basal levels of miRNAs according to gender or tobacco habits (data not shown).
The quantification of miRNAs was carried out using the SYBR Green Real-Time (RT) polymerase chain reaction (PCR) (Thermo-Fisher Scientific, Waltham, MA, USA). Briefly, 1 ng of template RNA was reverse transcribed (in 20 µL) using a stem-loop primer. For the PCR reaction, 1 µL of RT product was used. The PCR was carried out using the Magnetic Induction Cycler PCR detection system (Bio Molecular Systems, Upper Coomera, Australia). Both the RT and PCR reactions were performed in triplicate, in 3 separate experiments. The analysed miRNAs were considered as present when the threshold cycle values were lower than 30. The U6 snRNA was used as the house-keeping gene. The primers for U6 snRNA were forward, GCT TCG GCA CAT ATA CTA AAA T, and reverse, CGC TTC ACG AAT TTG CGT GTC AT. The forward- and reverse-transcribed primers for the different miRNAs are listed in
There were no differences in the basal levels of miRNAs according to gender or tobacco habits (data not shown).
3
Quantification of RPE/Choroid Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
On day 6 following laser-induced CNV and day 11 following NaIO3-induced retinal degeneration, individual RPE/choroid fractions were isolated from mice and stored at –80°C until use. RNA was isolated using the miRNEASY Kit (Qiagen, Valencia, CA, USA). Absorbance A260/A280 ratio (Take 3 Micro-Volume Plates; Biotek, Winooski, VT, USA) was used to measure the purity of RNA, and samples with measurements of 1.8 to 2.1 were used to generate first-strand cDNA (Qiagen). Using the Realplex 2 Mastercyler (Eppendorf, Hauppauge, NY, USA), PCR amplifications for genes of interest (Table 1 ) were performed as previously described.47 (link) Quantitative values were obtained using cycle number (Ct value) with values normalized to either β-actin or 36B4.48 (link)
4
Investigating αSMA Expression and Cellular Mechanics
5
Western Blot Analysis of Cellular Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the Western blot analysis, cells were washed with cold PBS and lysed by using a PRO-PREP protein extraction solution (iNtRON Biotechnology, Gyeonggi, Korea). The protein concentration of each sample was determined by spectrophotometry using Take3 Micro-Volume Plates (BioTek Instruments Inc., Winooski, VT, USA). Samples were loaded onto a polyacrylamide gel and subjected to sodium dodecyl sulfide-polyacrylamide gel electrophoresis, followed by electrophoretic transfer to nitrocellulose membrane. The nitrocellulose membranes were blocked with 5% skim milk in Tris-buffered saline (TBS), and then incubated with primary antibodies against Nrf2, HO-1, C/EBPα, PPARγ, PCNA, and β-actin at room temperature. Membranes were then washed with TBS and incubated with horseradish peroxidase-conjugated secondary antibody at room temperature. The specific protein bands were visualized on X-ray film via chemiluminescence using enhanced chemiluminescence (ECL) reagent (Pierce Biotechnology Inc., Rockford, IL, USA). The density of specific bands was calculated using Image J (NIH, Bethesda, MD, USA).
6
Quantifying Gene Expression by RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA from biopsy samples were extracted in Qiazol solution using homogenizer followed by RNeasy kit (Qiagen, Toronto, Canada). RNA prepared from cultured cells was using RNeasy kit. RNA was quantified using absorbance 260 nm and evaluated the purity by ratio of 260/280 (Epoch, Take3 Micro-Volume Plates, BioTek, Winooski, USA). 1ug of RNA was used for reverse transcription reaction (SuperScript® VILO cDNA Synthesis Kit, Life Technology, Burlington, Canada). 1/200 of synthesized cDNA was setup for real-time PCR using SYBR selection master mix (Life Technology, Burlington, Canada) on a StepOne Plus real-time PCR system (Life Technology, Burlington, ON). The following primers are used to evaluate the expression level normalized with internal GAPDH control. (Primers for EYA1: forward-GGACAGGACCTAAGCACATA;reverse-GTACACCAGTTGCCAAACAT; Primers for GAPDH: forward-AAGATCATCAGCAATGCCTCC; reverse- TGGACTGTGGTCATGAGTCCTT).
7
Quantifying Gene Expression in Laser-Induced Mouse Eye
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Retina and RPE/choroid fractions of the mouse eye were isolated on day 6 following laser-induced photocoagulation and stored at −80°C until use. Using the miRNeasy Kit (QIAGEN, Valencia, CA), total RNA was isolated and purified, and RNA with a 260:280 ratio of 1.95–2.1 (Take 3 Micro-Volume Plates, Biotek, Winooski, VT) was used to generate first-strand cDNA (QIAGEN). PCR amplifications were performed in triplicate as previously described56 (link) using the Realplex 2 Mastercycler (Eppendorf, Hauppauge, NY). Primer sequences for each gene product are listed in Table 1 . Cycle number (Ct value) was used to obtain quantitative values as previously described,63 (link) with genes of interest normalized to β-actin. Using the Z test, fold differences between AAV5-VMD2-fH and AAV5-mCherry in the presence or absence of CNV (control) were determined.
qRT-PCR Primer Sequences
| Gene Name | Symbol | Forward Primer | Reverse Primer |
|---|---|---|---|
| Retinal pigment epithelium 65 | Rpe65 | 5′-TTCTGAGTGTGGTGGTGAGC-3′ | 5′-AGTCCATGGAAGGTCACAGG-3′ |
| Complement component 3 | C3 | 5′-TCAGATAAGGAGGGGCACAA-3′ | 5′-ATGAAGAGGTACCCACTCTGGA-3′ |
| Vascular endothelial growth factor A | Vegfa | 5′-AGCACAGCAGATGTGAATGC-3′ | 5′-TTTCTTGCGCTTTCGTTTTT-3′ |
| Actin, β | Actb | 5′-AGCTGAGAGGGAAATCGTGC-3′ | 5′-ACCAGACAGCACTGTGTTG-3′ |
8
Robust Barley Genotyping Pipeline
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted from all the 60 genotypes by collecting 4–5 leaves from five-day-old barley seedlings. The extraction protocol was conducted as described in Mourad et al. [22 (link)]. DNA concentration was measured using spectrophotometry (Gen5TM microplate reader and image software with Take3TM micro-volume plates (BioTek, Winooski, VT, USA). DNA of each genotype was digested using two restriction enzymes, PstI and MspI, for genotyping-by-sequencing as described in [23 (link)]. Single nucleotide polymorphism (SNP) calling used the TASSEL 5.0 v2 GBS pipeline [24 (link)]. Identification of SNP markers, their physical position, and localization was carried out using the Barley cv. MorexV2 genome assembly. A set of 25,700 SNPs was obtained from the GBS data that was filtered for minor allele frequency (MAF >0.05), maximum missing sites per SNP <20%, and maximum missing sites per genotype <20%. Heterozygous loci were then marked as missing to obtain better estimates of marker effects (Peter Bradbury, personal communication) and the filtration was repeated based on the previous criteria.
9
Genomic DNA Extraction from Plant Leaves
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted from lines in the A-set and V-set for GBS using BioSprint 96 DNA Plant Kits (Qiagen, Hombrechtikon, Switzerland) from 2 to 3 leaves of 2-weeks-old seedlings. For the SSR marker test, DNA from a bulk of six leaves of 5 days old plants was extracted using DNAzol Reagent (Molecular Research Center, Inc. Technical Bulletin 6). The tissue was ground using liquid nitrogen then 300 μl DNAzol Reagent was added to this powder and left for 5 min at the room temperature. A volume of 300 μl chloroform was added to the previous mix and left at the room temperature for 5 min before it was centrifuged using Fisher Scientific accuSpin Micor 17 centrifuge (Loughborough, United Kingdom) at 12000 × g for 10 min. The washing process was done in three steps by adding three different washing solutions as follows: (1) absolute alcohol, (2) DNAzol + 75% Ethanol and (3) 75% alcohol only. All genotypes were centrifuged using the Fisher Scientific accuSpin Micor 17 centrifuge for 4 min at 5000 × g after each washing step. The extracted DNA was then re-suspended in 150 μl of TE buffer. DNA concentration was measured using spectrophotometry (Gen5TM microplate reader and image software with Take3TM micro-volume plates [BioTek, Winooski, VT, United States]).
10
Cardiac Tissue Protein Extraction Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For protein extraction of cardiac tissue, 20–40 mg of heart (atria and ventricles) tissue was placed in lysis buffer (0.01 g bovine serum albumin, 5 μl of Triton-X 100, 5 μl protease inhibitor cocktail (Calbiochem, MilliporeSigma, St. Louis, MO, cat. #535140), and 990 μl PBS) and homogenized in bead beater for 15 min. Next, samples were incubated at 4 °C on a rocker for 15 min, then centrifuged at 15,000 RPM for 5 min at 4 °C. The supernatant was removed and frozen at − 20 °C. Samples were then filtered in 0.22 μm syringe-driven filter unit (Millipore, St. Louis, MO, cat. #SLGP033RS). Samples were checked for purity and protein quantification using Take3™ Micro-Volume Plate (BioTek, Winooski, VT) read on Epoch™ Microplate Spectrophotometer with Gen5 Software (BioTek, Winooski, VT).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!