Superscript 2 first strand cdna synthesis system

Manufactured by Thermo Fisher Scientific

Sourced in United States

The SuperScript II first-strand cDNA synthesis system is a laboratory equipment product that enables the conversion of RNA into complementary DNA (cDNA) for use in various molecular biology applications. The system provides the necessary reagents and protocols to facilitate this cDNA synthesis process.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

First-Strand cDNA Synthesis System First-Strand Synthesis System CDNA synthesis system Superscript II system Superscript II

17 protocols using superscript 2 first strand cdna synthesis system

qRT-PCR Analysis of p62 Expression

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated using a TRIzol isolation kit. Whole cDNA was synthesized from 1 µg of purified RNA by the SuperScript II First-Strand cDNA synthesis system (Invitrogen). Primer sequences for p62 qRT-PCR were described previously by Hu et al. (2012) (link). The qRT-PCR was performed with SYBR green brilliant III ultrafast reagent kit (MX3000P; Agilent Technologies) following the manufacturer’s protocol. The results of qRT-PCR assays presented are a mean of three independent RNA preparations. Each sample was analyzed in triplicates.

He Y., She H., Zhang T., Xu H., Cheng L., Yepes M., Zhao Y, & Mao Z. (2018). p38 MAPK inhibits autophagy and promotes microglial inflammatory responses by phosphorylating ULK1. The Journal of Cell Biology, 217(1), 315-328.

+ Open protocol

+ Expand

Quantifying mRNA Expression Levels

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNAs in cells and tissues were extracted using Trizol reagent (15596018, Thermo Fisher Scientific, USA), and NanoDrop (FSC-6539918, (http://eGeneralMedical.com/), USA) was used to determine RNA concentration and purity. Total RNA (1 μg) was converted into cDNA using a SuperScript II first-strand cDNA synthesis system (Invitrogen, USA). The mRNA expression levels were determined by SYBR-Green PCR Master Mix (Thermo Fisher Scientific, USA) in the 7500 Real-Time PCR System (Thermo Fisher Scientific, USA). The PCR program was set as follows: pretreatment at 95°C for 30 s, at 60°C for 30 s, at 60°C for 30 s for 45 cycles. The 2^-ΔΔCT method was used to determine the expression levels of RT-PCR products [16 (link)]. Primers are summarized in Table 1.

Wang T., Tang X., Zhang Y., Wang X., Shi H., Yin R, & Pan C. (2022). Delivery of miR-654-5p via SonoVue Microbubble Ultrasound Inhibits Proliferation, Migration, and Invasion of Vascular Smooth Muscle Cells and Arterial Thrombosis and Stenosis through Targeting TCF21. Oxidative Medicine and Cellular Longevity, 2022, 4757081.

+ Open protocol

+ Expand

Quantifying mRNA Expression Levels by RT-qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA of cells were extracted using TRIzol^® reagent (cat. no. 15596018; Thermo Fisher Scientific, Inc.), and RNA concentration was measured using a UV1700PC Nanodrop spectrophotometer (Nanodrop Technologies; Thermo Fisher Scientific, Inc.) and diluted to 500 ng/µl. Reverse transcription was performed using Superscript II first-strand cDNA synthesis System (Invitrogen; Thermo Fisher Scientific, Inc.). The mRNA expression levels were determined by RT-qPCR using SYBR Green Real Time PCR kit (cat. no. 204057; Qiagen China, Co., Ltd.) in a 7500 Real-Time PCR system (Applied Biosystems, Inc.). A volume of 0.5 µl forward primer (10 µM), 0.5 µl reverse primer (10 µM), 4 µl cDNA, 5 µl SYBR Green I nucleic acid gel stain (cat. no. S9430; Sigma-Aldrich; Merck KGaA) were mixed into 10 µl solution. The thermocycler conditions for the qPCR assay was set as follows: Pretreatment at 95°C for 1 min, followed by 40 cycles of 95°C for 30 sec, 58°C for 20 sec and 70°C for 20 sec. The final extension was performed at 72°C for 7 min and then held at 4°C. The sequences of primers are listed in Table I. The 2^−ΔΔCq method was used to determine the expression levels of RT-PCR products (35 (link)).

Xiong J., Ni J., Chen C, & Wang K. (2020). miR-148a-3p regulates alcoholic liver fibrosis through targeting ERBB3. International Journal of Molecular Medicine, 46(3), 1003-1012.

+ Open protocol

+ Expand

Quantitative PCR Analysis of Arabidopsis Transcripts

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from Arabidopsis seedlings using the RNeasy plant mini kit (Qiagen). Then, cDNAs were synthesized from 2 µg total RNA using SuperScript II first-strand cDNA synthesis system (Invitrogen) according to the manufacturer's instructions. Quantitative PCR was performed using the CFX96 real-time PCR detection system (Bio-Rad) and SYBR Green PCR Master Mix (Applied Biosystems). PCR reactions were performed in triplicate for each sample, and the expression levels were normalized to that of a ubiquitin gene. All primers used for this assay are listed in Supplemental Table S1.

Xu D., Li J., Gangappa S.N., Hettiarachchi C., Lin F., Andersson M.X., Jiang Y., Deng X.W, & Holm M. (2014). Convergence of Light and ABA Signaling on the ABI5 Promoter. PLoS Genetics, 10(2), e1004197.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using TRIzol reagent (BY11909, Hefei Bomei Biotechnology Bo., Ltd., China), and Nanodrop (Thermo Scientific™, San Diego, CA, U.S.A.) was used to measure the concentration of RNA, which was then diluted to 500 ng/μl. Superscript II first-strand cDNA synthesis System (Invitrogen, U.S.A.) was used to determine reverse transcription. The mRNA expression levels were determined by quantitative real-time polymerase chain reaction (qRT-PCR) using SYBR Green Real Time PCR kit (204057, QIAGEN, https://www.qiagen.com/cn/products/, China). Next, 4 μl cDNA was mixed with 5 μl SYBR (codeDRR041A, Takara, Japan) and 1 μl Primer. PCR cycle was conducted as follows: pretreatment at 94°C for 2 min, at 94°C for 30 s, at 63°C for 30 s, at 72°C for 1 min (35 cycles), finally, chain extension at 72°C for 7 min and kept at 4°C. Sequences of primers used were listed in Table 1. The expression levels of RT-PCR products were determined by the 2^−ΔΔC_T method [17 (link)].

Zhang J., Zhang Z., Sun J., Ma Q., Zhao W., Chen X, & Qiao H. (2019). MiR-942 regulates the function of breast cancer cell by targeting FOXA2. Bioscience Reports, 39(11), BSR20192298.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

0.1 µg of total RNA was reverse transcribed with oligo(dT)n, using the SuperScript II First Strand cDNA Synthesis system (Invitrogen) according to the manual. qPCR was performed using SYBR Green method (Applied Biosystems, Foster city, CA, USA). Individual reaction contains diluted cDNA, 400 nM forward and reverse primers each, and 12.5 µL 2x PCR master mixes. PCR reaction was denatured at 95°C for 10 minutes, followed by 40 cycles of 95°C for 15 seconds and 60°C for 1 minute. The fold changes were calculated by the 2^−△△Ct method using ABI Prism 7500 SDS Software. The specific primers used for amplification of Dnmt3L were 5′ CTCTGGAAGAGCAATGGCTG 3′ (forward) and 5′ GACTTCGTACCTGATCATCTC 3′ (reverse), Plau 5′ GTGGCAGTGTACTTGGAGCT 3′ (forward) and 5′ GCATCTATCTCACAGTGCTC 3′ (reverse), CD72 5′ GAACAGCGCATCTAACCATCT 3′ (forward) and 5′ GTCGCAGTTGGTTGCTCTG 3′ (reverse), Uba7 5′ GAGTTATACTCCAGGCAGCT 3′ (forward) and 5′ CACTGAGCAGCCAAGTCAG 3′ (reverse), Pdrg1 5′ GAGTGTCTCTGAAGATGTGAT 3′ (forward) and 5′ GTTGACTCCGCAGCCTTTCT 3′ (reverse), and β-actin transcript levels for normalization 5′ CAAGCAGGAGTACGATGAGT 3′ (forward) and 5′ GCCATGCCAATGTTGTCTCT 3′ (reverse), respectively.

Zhao W., Wei L., Tan D., Su G., Zheng Y., He C., Mao Z.J., Singleton T.P, & Yin B. (2014). Cellular Intrinsic Mechanism Affecting the Outcome of AML Treated with Ara-C in a Syngeneic Mouse Model. PLoS ONE, 9(10), e109198.

+ Open protocol

+ Expand

Arabidopsis Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from Arabidopsis seedlings using the RNeasy Plant Mini kit (Qiagen) [26 (link)]. Reverse transcription was performed using the SuperScript II First-strand cDNA Synthesis System (Invitrogen) according to manufacturer's instructions. qPCR analysis was performed using Power SYBR Green PCR Master Mix (Applied Biosystems) with a Bio-Rad CFX96 real-time PCR detection system. Each experiment was repeated with three independent samples, and qPCR reactions were performed with three technical replicates for each sample. The primers used for qPCR are listed in Supplementary Table 1. Relative RNA expression was calculated with UBQ1 (AT3G52590) as the endogenous reference control. For Figure 3 showing N concentration series, the value of WT at zero N concentration was set at 1 for each gene. In Figure 4A, relative transcript levels of the genes were compared to NIA1 of WT Dc (set to 1). Representative gene profiles were repeated with ACTIN 2 (At3g18780) as endogenous reference. Data presented are means of three biological parallels, and error bars represent standard deviation of the sampling distribution of the mean. Analysis of variance were tested by least significant difference at P = 0.01(LSD0.01), based on SAS statistical analysis package (version 9.1.3, SAS Institute, Cary, NC, USA).

Huang L., Zhang H., Zhang H., Deng X.W, & Wei N. (2015). HY5 regulates Nitrite Reductase 1 (NIR1) and Ammonium Transporter1;2 (AMT1;2) in Arabidopsis seedlings. Plant science : an international journal of experimental plant biology, 238, 330-339.

+ Open protocol

+ Expand

Quantifying EMT-related Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA isolation and RT were conducted using SV Total RNA Isolation System (Promega) and Superscript II First-Strand cDNA synthesis system (Invitrogen), retrospectively. The forward and reverse primers used for regular PCR were: 5′-TGATGAAGAGGAAAGACTACAG-3′ and 5′-GCTCA CATATTCCTTGTCACAG-3′ (Slug), 5′-GGAGTCCGCAGTCTTACGAG-3′ and 5′-TCTGGAGGA CCTGGTAGAGG-3′ (TWIST), 5′-CGAAAGGCCTTCAACTGCAAA-3′ and 5′-ACTGGTACTTCTT GACATCTG-3′ (Snail), 5′-GTCCTGGGCAGAGTGAATTTT-3′ and 5′-ATTCAGCGTGACTTTGG TGGA-3′ (E-cadherin), 5′-ACCAACGAGAAGGTGGAGCTG-3′ and 5′-TCGTTGGTTAGCTGGTC CACC-3′ (Vimentin), and 5′-GGCGGCACCACCATGTACCC-3′ and 5′-AGGGGCCGGACTCG TCATACT-3′ (β-actin). Primers used in qPCR included 5′-TCGGACCCACACATTACCTT-3′ and 5′-TGACCTGTCTGCAAATGCTC-3′ (Slug), 5′-CTCAGCTACGCCTTCTCG-3′ and 5′-ACTGTCCATTTTCTCCTTCTCTG-3′ (TWIST), 5′-GGAAGCCTAACTACAGCGAG-3′ and 5′-CAGAGTCCCAGATGAGCATTG-3′ (Snail), and 5′-ACCCCTGAAGTACCCCAT-3′ and 5′-CCACACGCAGCTGATTGT-3′ (β-actin). In qPCR, β-actin gene was used as normalization controls and all experiments were done in triplicates. qPCR master mix was purchased from Apex Bioresearch Products.

Carpenter R.L., Paw I., Dewhirst M.W, & Lo H.W. (2014). Akt phosphorylates and activates HSF-1 independent of heat shock, leading to Slug overexpression and epithelial-mesenchymal transition (EMT) of HER2-overexpressing breast cancer cells. Oncogene, 34(5), 546-557.

+ Open protocol

+ Expand

RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from the cells using the TRIzol reagent (15596018, Thermo Fisher Scientific, USA), and the concentration of the RNA was detected by using Nanodrop (FSC-6539918, eGeneralMedical.com, USA) and diluted to 500 ng/μL. For miRNAs, NCode VILO miRNA cDNA Synthesis and EXPRESS SYBR GreenER miRNA qRT-PCR Kits (Life Technologies) were applied for detecting the expression levels. For mRNAs, total RNA (1 μg) was converted into cDNAs using a Superscript II first-strand cDNA synthesis system (Invitrogen, USA). The mRNA expression levels were determined by SYBR-Green PCR Master Mix (Thermo Fisher Scientific, USA) in the 7500 Real-Time PCR system (Thermo Fisher Scientific, USA). Conditions of the PCR cycle were set as follows: pretreatment at 95°C for 30 s, followed by 60°C for 30 s and 60°C for 30 s for 45 cycles. The 2^−ΔΔCT method was used to determine the expression levels of RT-PCR products (Livak and Schmittgen [24 (link)]). All primer sequences used are listed in Table 1.

Wang B., Yang S., Jia Y., Yang J., Du K., Luo Y., Li Y., Wang Z., Liu Y, & Zhu B. (2022). PCAT19 Regulates the Proliferation and Apoptosis of Lung Cancer Cells by Inhibiting miR-25-3p via Targeting the MAP2K4 Signal Axis. Disease Markers, 2022, 2442094.

+ Open protocol

+ Expand

RNA Extraction and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from cells using TRIzol (Molecular Research Center, Cincinnati, OH, USA) approach, as described previously (Yin et al., 2006a (link)). 0.1 ug of total RNA was reverse transcribed with oligo (dT)n, using the SuperScript II First Strand cDNA Synthesis system (Invitrogen) according to the manual. The specific primers in PCR for detecting expression of HSV-TK were 5′-TTATGGCTTCGTACCCCGGCCA-3′ (forward) and 5′-TTGTTCTGTCTTTTTATTG-3′ (reverse), and of VSV-G were 5′-TTATGAAGTGCCTTTTGTACTT-3′ (forward) and 5′-TTGCTTTCCAAGTCGGTTCATC-3′ (reverse), repectively. QPCR was performed using SYBR Green method (Applied Biosystems, Foster City, CA, USA). Individual reaction contains diluted cDNA, 400 nM forward and reverse primers each, and 12.5 μl 2×PCR master mixes. PCR reaction was denatured at 95°C for 10 minutes, followed by 40 cycles of 95°C for 15 seconds and 60°C for 1 minute. The fold changes were calculated by the 2^−ΔΔCt method using ABI Prism 7500 SDS Software. The specific primers used for amplification of Connexin 43 were 5′-CGCCTATGTCTCCTCCTG-3′ (forward) and 5′-ACAATTACCACCGCTCA-3′ (reverse), and GAPDH transcript levels for normalization 5′-GCCAAGGTCATCCATGACAACT-3′ (forward) and 5′-GCCATCACGCCACAGTTTC-3′ (reverse), respectively.

Hu C., Chen Z., Zhao W., Wei L., Zheng Y., He C., Zeng Y, & Yin B. (2014). Vesicular Stomatitis Virus G Glycoprotein and ATRA Enhanced Bystander Killing of Chemoresistant Leukemic Cells by Herpes Simplex Virus Thymidine Kinase/Ganciclovir. Biomolecules & Therapeutics, 22(2), 114-121.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!