Cells (1×105 cells/well) were seeded into 6-well plates and cultured for 24 h at 37°C with 5% CO2. Cell transfection was performed when the cells reached 80% confluency. The miR-532-5p mimic and mimic-negative control (mimic-NC; Invitrogen; Thermo Fisher Scientific, Inc.) were transfected directly into cells. For overexpression of miR-532-5p, the cells were transfected with mimic at a final concentration of 25 nM for 48 h at 37°C. For pcDNA-NC (empty vector, Invitrogen; Thermo Fisher Scientific, Inc.) and pcDNA-CCND1, full length transcript of CCND1 was amplified from cDNA obtained from 293T cells by PCR using PrimeSTAR® HS DNA polymerase (Takara Bio, Inc.), and was transfected at a final concentration of 500 ng for 48 h at 37°C. The PCR amplification product was inserted into the KpnI and BamHI sites of the pcDNA vector (Invitrogen; Thermo Fisher Scientific, Inc.), which was termed pcDNA-CCND1. Transfection was performed using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. Transfection efficiency was determined by RT-qPCR 48 h after transfection.
Pcdna nc
Manufactured by Thermo Fisher Scientific
Sourced in United States
PcDNA-NC is a plasmid vector designed for gene expression studies in mammalian cell lines. It provides a backbone for cloning and expressing genes of interest in transfected cells.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 2000, by Thermo Fisher Scientific (8 mentions)
Si nc, by Thermo Fisher Scientific (7 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (5 mentions)
Si nc, by GenePharma (4 mentions)
Sh nc, by Thermo Fisher Scientific (3 mentions)
Pcdna nc, by GenePharma (3 mentions)
Anti mir nc, by RiboBio (2 mentions)
Shrna nc, by Thermo Fisher Scientific (2 mentions)
Shrna nc, by GenePharma (2 mentions)
Anti mir nc, by Thermo Fisher Scientific (2 mentions)
Lipofectamine 3000 reagent, by Thermo Fisher Scientific (2 mentions)
Pcdna vector, by Thermo Fisher Scientific (1 mentions)
Nc mimic, by Thermo Fisher Scientific (1 mentions)
Primestar hs dna polymerase, by Takara Bio (1 mentions)
Si oip5 as1, by GenePharma (1 mentions)
Anti mir 377 3p, by GenePharma (1 mentions)
Anti mir nc, by GenePharma (1 mentions)
Si cav 1, by Thermo Fisher Scientific (1 mentions)
Mir nc, by RiboBio (1 mentions)
Lipofectamine 2000 reagent, by Thermo Fisher Scientific (1 mentions)
16 protocols using pcdna nc
1
Overexpression of miR-532-5p and CCND1 in Cells
2
Silencing OIP5-AS1 and Overexpressing FOSL2 in CDDP-Resistant Osteosarcoma
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Small interference RNA (siRNA) against OIP5-AS1 (si-OIP5-AS1, 5ʹ-GCTCCTAGGATTCCAGTTA-3ʹ) and its negative control (si-NC), miR-377-3p mimic (miR-377-3p) and its control (miR-NC), miR-377-3p inhibitor (anti-miR-377-3p) and its scramble (anti-miR-NC) were purchased from GenePharma (Shanghai, China). The sequences of OIP5-AS1 and FOSL2 were inserted into pcDNA3.1 vector (pcDNA-NC; Invitrogen, Carlsbad, CA, USA) to construct overexpression plasmid (pcDNA-OIP5-AS1 or pcDNA-FOSL2). Whereafter, MG63/CDDP and Saos-2/CDDP cells (2 × 105 cells/well) were seeded in 6-well plates, and transfected with these plasmids and oligonucleotides for 48 h according to the producer’s instructions of Lipofectamine 2000 (Invitrogen).
3
Propofol and Metformin Modulate Cav-1 in HT-22 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HT-22 cells were treated with 100 μmol/L propofol and 10 μmol/L metformin for 24 h. Then, si-NC, si-Cav-1, pcDNA-NC and pcDNA-Cav-1 purchased from Invitrogen (Invitrogen, CA, USA) were transfected into HT-22 cells using Lipofectamine 3000. After transfection for 4–6 h, medium containing 10% FBS was replaced.
4
Targeting circ_0003998 and miR-218-5p in Doxorubicin Resistance
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mimic and inhibitor of miR-218-5p (miR-218-5p and anti-miR-218-5p) and their negative control (miR-NC and anti-miR-NC) were obtained from RIBOBIO (Guangzhou, China). Small interfering RNA (siRNA) targeting circ_0003998 covalent closed junction (si-circ_0003998) or siRNA negative control (si-NC), the scramble shRNA sequence or shRNA targeting circ_0003998 (sh-NC or sh-circ_0003998), pDNA-EIF5A2 overexpression vector (pcDNA-EIF5A2) and empty plasmid (pcDNA-NC) were synthesized by Invitrogen. Afterwards, DOX-resistant cells were plated in six-well plate (5 × 105 cells/well), allowed to adhere for 24 h and transfected with these siRNC (10 nM), miRNA mimics or inhibitor (30 nM) or pcDNAs (10 nM) using Lipofectamine 2000 (Invitrogen).
5
LncRNA-ATB Regulates TGF-β1 Induced HK-2 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HK-2 cells (ATCC® CRL-2190™) were cultured in Dulbecco’s medium supplemented with 10% fetal bovine serum (FBS), L-glutamine, bovine pituitary extract (BPE), and epidermal growth factor (EGF) and placed in an incubator containing 5% CO2. The cells were cultured in 96-well plates at a density of 1×105 for 24 hours and then the cells were treated with TGF-β1 (10 ng/mL) for 12 hours, 24 hours, and 48 hours, respectively. pcDNA-NC, pcDNA-LncRNA-ATB, ShRNA-NC, ShRNA-LncRNA-ATB-1, and ShRNA-LncRNA-ATB-2 were purchased from GenePharma (Shanghai, China). The cells after treatment with TGF-β1 were transfected with pcDNA-NC, pcDNA-LncRNA-ATB, ShRNA-NC, ShRNA-LncRNA-ATB-1, and ShRNA-LncRNA-ATB-2, respectively according to the manufacturer’s protocol, by using Lipofectamine 2000 reagent (Invitrogen).
6
Modulating circDONSON and miR-802 Axis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The miR-802 mimic, miR-802 inhibitor (anti-miR-802) and their negative control (miR-NC mimic, anti-miR-NC) were achieved by RiboBio (Guangzhou, China). Small interfering RNA (siRNA) sequences targeting circDONSON (si-circDONSON, 5′-AUGUAAAGGUGUUGAUUCCUU-3′), siRNA negative control (si-NC, 5′-UUCUCCGAACGUGUCACGU-3′), pcDNA-BMI1 overexpression vector (pcDNA-BMI1), empty vector (pcDNA-NC), and lentiviral encoding either short hairpin RNA (shRNA)-targeting circDONSON (sh-circDONSON) or a scrambled control sequence (sh-NC) were designed and synthesized by Invitrogen (Carlsbad, CA, USA). Then transfection of these mimics or vectors was carried out using Lipofectamine 2000 (Invitrogen).
7
miR-195-5p Regulation of E2F3 in AMC-HN-8 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
miR-195-5p mimic and the negative control miRNA (miRNA-NC) were obtained from Guangzhou RiboBio Co., Ltd. The E2F3 overexpression vector pcDNA-E2F3 and empty control vector pcDNA-NC were constructed by Shanghai GenePharma Co., Ltd. The sequences were as follows: miR-195-5p mimic sense, 5'-UAGCAGCACAGAAAUAUUGGC-3'; miR-195-5p mimic antisense, 5'-CAAUAUUUCUGUGCUGCUAUU-3'; mimics negative control (miR-NC) sense, 5'-UUCUCCGAACGUGUCACGUTT-3'; miR-NC antisense, 5'-ACGUGACACGUUCGGAGAATT-3'. Cells were plated into 6-well plates (1x106 cells per well), and transfection was performed when cells at the logarithmic growth phase reached 80% confluence. According to the product instructions, AMC-HN-8 cells were transfected with miR-195-5p mimic (50 nM), miR-NC (50 nM), pcDNA-E2F3 (100 nM) and pcDNA-NC (100 nM) using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.). The transfection efficiencies were assessed by RT-qPCR at 48 h after transfection.
8
Regulation of Glioma Cell Pathways by circRNA and miRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Oligonucleotides including small interfering RNA (siRNA) against circ_0037655 (si-circ_0037655), miR-1229-3p mimic, miR-1229-3p inhibitor and their negative controls (si-NC, miR-NC mimic and miR-NC inhibitor) were directly purchased from GenePharma (Shanghai, China). Vectors of shRNA hairpin RNA (shRNA) against circ_0037655 and the negative control (sh-circ_0037655 and sh-NC), overexpression vector pCE-RB-Mam-circ_0037655 (oe-circ_0037655) and the basic pCE-RB-Mam vector (oe-NC) were obtained from RiboBio (Guangzhou, China). ITGB8 sequence was cloned into the pcDNA vector (pcDNA-NC; Invitrogen, Carlsbad, CA, USA) to generate the pcDNA-ITGB8. Transfection was performed in T98G and LN229 cells using Lipofectamine™ 3000 (Invitrogen), according to the provided guidelines for users.
9
Regulation of Notch2 by miR-15a-5p
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The miR-negative control (NC), miR-15a-5p mimics, miR-15a-5p inhibitor, pcDNA3.1 Notch2 (pcDNA-Notch2), and pcDNA-NC were synthesized by Invitrogen. The lentiviral vector, short hairpin-LINC00662, and sh-NC were synthesized by GenePharma (Shanghai, China). The MG63 and U2OS cells were cultured to a confluence of 80%, and were subsequently transfected or co-transfected with the aforementioned agents using Lipofectamine 3000 (Invitrogen).
10
AKIP1 Modulation in ATC Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The AKIP1 siRNA (si-AKIP1) and negative control (si-NC) were commercially designed and synthesized by Shanghai GenePharma Co., Ltd. (Shanghai, China). The AKIP1 overexpression plasmids (pcDNA-AKIP1) and negative control (pcDNA-NC) were obtained from Guangzhou Ribobio Co., Ltd. (Guangzhou, China). ATC cells were cultured and transfected with 50 nM siRNA (si-AKIP1 or si-NC) or 0.8 μg of plasmids (pcDNA-AKIP1 or pcDNA-NC) with Lipofectamine® 3000 (Invitrogen, USA) for 6 h. The AKIP1 siRNA sequence was as follows: sense, 5’ GTGGGCTCAAATGACTTAATT 3’; antisense, 5’ TTAAGTCATTTGAGCCCACTT 3’. The non-transfected cells served as normal controls.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!