Total RNA was purified using the RNeasy kit (Qiagen) and cDNA was prepared using the SuperScript RT-PCR system (Invitrogen). Quantitative RT-PCR was performed using Absolute Blue QPCR SYBR low ROX Mix (Thermo Scientific) according to the manufacturer's protocol. Reactions were carried out in duplicate for each target transcript using a 7500 Fast Real-Time PCR System (Applied Biosystems). The comparative CT method was applied for quantification of gene expression, and values were normalised against Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as control. Results were expressed as fold change in mRNA levels. Following primers were used: PHGDH for (5′-ATCTCTCACGGGGGTTGTG-3′), PHGDH rev (5′-AGGCTCGCATCAGTGTCC3′), PSAT1 for (5′-CGGTCCTGGAATACAAGGTG3′), PSAT1 rev (5′- AACCAAGCCCATGACGTAGA-3′), ATF4 for (5′-GGGACAGATTGGATGTTGGAGA-3′), ATF4 rev (5′-ACCCAACAGGGCATCCAAGT-3′), MTHFD2 for (5′-TGCTGCAGGTATTCCAAATC-3′), MTHFD2 rev (5′-GGGTTTGGCAGTTACAGGAT-3′), ATF4 for (5′-GGGACAGATTGGATGTTGGAGA-3′), ATF4 rev (5′-ACCCAACAGGGCATCCAAGT-3′), GAPDH for (5′-AGCCACATCGCTCAGACAC-3′), GAPDH rev (5′-GCCCAATACGACCAAATCC-3′), TDP1 for (5′-ATGGTGATAAGCGAGAGGCT-3′), TDP1 rev (5′-CGGAGGCCTTCTTCATAGAG-3′).
Superscript rt pcr system
Manufactured by Thermo Fisher Scientific
Sourced in United States
The SuperScript RT-PCR system is a laboratory equipment product designed for reverse transcription and polymerase chain reaction (RT-PCR) analysis. It provides the core functions necessary for RNA-to-cDNA conversion and subsequent PCR amplification.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy kit, by Qiagen (7 mentions)
7500 fast real time pcr system, by Thermo Fisher Scientific (5 mentions)
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Sybr green, by Thermo Fisher Scientific (3 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (2 mentions)
Kapa sybr fast qpcr kit, by Roche (2 mentions)
Rnaqueous small scale phenol free total rna isolation kit, by Thermo Fisher Scientific (2 mentions)
Real time pcr system, by Thermo Fisher Scientific (2 mentions)
Platinum taq high fidelity, by Thermo Fisher Scientific (2 mentions)
Fast sybr green master mix, by Thermo Fisher Scientific (2 mentions)
Absolute blue qpcr sybr low rox mix, by Thermo Fisher Scientific (1 mentions)
Ex taq, by Takara Bio (1 mentions)
Thermocycler, by Thermo Fisher Scientific (1 mentions)
Superscript 3 rt enzyme, by Thermo Fisher Scientific (1 mentions)
Random hexamer primer, by Promega (1 mentions)
Rnaseout recombinant rnase inhibitor, by Thermo Fisher Scientific (1 mentions)
Rna isolation kit, by Qiagen (1 mentions)
Evagreen, by Bio-Rad (1 mentions)
Dnase 1, by Qiagen (1 mentions)
Rneasy kit, by Takara Bio (1 mentions)
20 protocols using superscript rt pcr system
1
Quantitative RT-PCR Analysis of Metabolic Genes
2
Isolation and Characterization of JEV Escape Mutants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Vero cells seeded in a 6-well plate (3 × 105 cells/well) were infected with the JEV Nakayama strain at a multiplicity of infection (MOI) of 0.1. After 1 h of incubation at 37 °C, the cells were washed thrice with PBS and then cultured with the Vero cell culture medium containing 3H12 at a concentration of 16.0 or 8.0 μg/mL. Culture supernatants were transferred to new cells after 4 days of incubation. This procedure was repeated 5 times. Moreover, the passage control virus, which was passaged in the absence of an antibody, was generated.
Viral RNA was extracted from the culture supernatant of the cells infected with escape mutant using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). Reverse transcription polymerase chain reaction (RT-PCR) was performed using the Superscript RT-PCR system (Invitrogen, Carlsbad, CA, USA) and Ex Taq (Takara, Shiga, Japan) to amplify the E gene. Primer information is presented inSupplementary Table S1 . The E gene sequences between the escape mutant and passage control virus were compared using Genetyx ver. 10 (Genetyx, Tokyo, Japan).
Viral RNA was extracted from the culture supernatant of the cells infected with escape mutant using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). Reverse transcription polymerase chain reaction (RT-PCR) was performed using the Superscript RT-PCR system (Invitrogen, Carlsbad, CA, USA) and Ex Taq (Takara, Shiga, Japan) to amplify the E gene. Primer information is presented in
3
Reverse Transcription Protocol for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Reverse transcription (RT) was performed using the Superscript RT-PCR system (Invitrogen) with the method described in the manual. Two master mix solutions were prepared in separate 0.2-ml tubes. Master mix 1 contained 1 µl deoxynucleoside triphosphate (dNTP) mix (10 mM each; TaKaRa Bio Co., Japan), 2 µl random hexamer primers (50 ng/µl; Promega), total RNA, and RNase-free water up to 13 µl. Master mix 2 contained 4 µl 5× first-strand buffer, 1 µl 0.1 M dithiothreitol (DTT), 1 µl Superscript III RT enzyme (200 units/µl), 1 µl RNaseOUT recombinant RNase inhibitor (Invitrogen; 40 units/µl). Master mix 1 solution was incubated at 65°C for 5 min and put on ice for 2 min. The contents of the tube were collected by brief centrifugation before master mix 2 was added. The tube was transferred to a thermocycler (Applied Biosystems) and incubated at 25°C for 5 min, 50°C for 60 min, and 70°C for 15 min. The cDNA was stored at −20°C until quantitative PCR analysis. Control samples containing the same concentration of RNA, but on which reverse transcription was not performed, were prepared for each gene (nirS, nirK, and nosZ) and subjected to quantitative PCR to ensure that all genomic DNA was removed by DNase.
4
Quantification of Cytokine mRNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from cultured cells was prepared using a RNA isolation kit (Qiagen; Valencia, CA, USA) according to manufacturer's protocols. Complementary DNA (cDNA) from 500 ng of total RNA was synthesized by reverse transcription using the SuperScript RT-PCR System (Invitrogen) according to manufacturer's instructions. Quantitative real-time RT-PCR (qRT-PCR) analysis was performed on a CFX-96 system using EvaGreen as a double-stranded DNA-specific dye according to the manufacture's instruction (Bio-Rad; Hercules CA, USA). Primers were designed as follows: 5′-ACCACCATCAAGGACTC-3′ and 5′-TGACCACTCTCCCTTTG-3′ for mouse TNF-α; 5′-TTCCAATGCTCTCCTAACAG-3′ and 5′-CTAGGTTTGCCGAGTAGATC-3′ for mouse IL-6; 5′-TCCTTCTTGGGTATGGAATC-3′; 5′-TAGAGGTCTTTACGGATGTC-3′ for β-actin. The expression levels of examined transcripts were compared to that of β-actin and normalized to the mean value of controls.
5
Quantitative gene expression analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Gene expression studies were performed using quantitative real time PCR (qRT-PCR). Total RNA was isolated using the RNeasy kit (TaKaRA). After DNase I (Qiagen, Hilden, Germany) digestion, one microgram of total RNA was reverse transcribed by random hexamers and Superscript RT-PCR System (Invitrogen, Carlsbad, CA, USA). After purification, the cDNA was used for qRT-PCR using specific primers for Egr-1, MCP-1, ICAM-1, SF-1, and Ki-67 [21 (link)]. Results were normalized to the expression level of the 18S rRNA.
6
Construction of PMCA1-SEP and Syntaxin1a-SEP Plasmids
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To construct PMCA1-SEP, a full length mouse PMCA1 (accession no. NM_001359506.1) was amplified by PCR from mouse adult brain cDNA generated using SuperScript RT-PCR system (Invitrogen) and subcloned into a StuI site of pCR-Blunt vector (Thermo Fisher Scientific). A DNA fragment encoding the N-terminal region of PMCA1 (a.a. 1–139) with linker sequence (STSGGSGGTGGS) and a fragment of super-ecliptic pHluorin (SEP) amplified from SypHy plasmid58 (link),59 (link) (a kind gift from Leon Lagnado) were amplified by PCR and cloned into an EcoRV site of pcDNA3.1(+) using In-Fusion Cloning Kit (Clontech). A DNA fragment encoding the C-terminal region of PMCA1 (a.a. 140-1,220) was PCR-amplified and cloned into a NotI site of pcDNA3.1(+) which contained the N-terminal region of PMCA1 and SEP using In-Fusion Cloning Kit. To construct Syntaxin1a-SEP, a full length mouse Syntaxin-1a (accession no. NM_016801.3) without the stop codon and a fragment of SEP were amplified by PCR and simultaneously cloned into a NheI/EcoRV site of pcDNA3.1(+). A DNA fragment encoding SypHy59 (link) was amplified by PCR and subcloned into a NheI/XbaI site of pcDNA3.1(+).
7
Quantitative RT-PCR Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using the RNeasy kit (Qiagen) and cDNA was prepared using the SuperScript RT-PCR system (Invitrogen) as per manufacturer's indications. Quantitative RT-PCR was performed using SYBR® Green PCR Master Mix (Life Technologies) according to the manufacturer's protocol. Reactions were carried out using a 7500 Fast Real-Time PCR System (Applied Biosystems). The comparative CT method was applied for quantification of gene expression; GAPDH or B2M were used as housekeeping genes. A list of the primers can be found in the Supplementary Information.
8
Total RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Spectrum™ Plant Total RNA Kit (Sigma‐Aldrich) was used for total RNA extraction from potato tuber. After reverse transcription using the SuperScript RT‐PCR system (Invitrogen, Waltham, MA, USA), cDNA was used to perform the quantitative real‐time PCR analysis. IQ SYBR Green Supermix (Bio‐Rad, Hercules, CA, USA) and iCycle (Bio‐Rad) were used in our experiment. LOC102577640 was used as an internal standard for data normalization and quantification (Stritzler et al., 2017 (link)). The six genes selected for validating the expression profiles obtained from microarray hybridisations, and their primers, are listed in Table S1 .
9
Quantitative Real-Time PCR Analysis of Cotton
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from cotton ovules was extracted using the Qiagen RNeasy kit and RNAqueous small-scale phenol-free total RNA isolation kit (Ambion) according to the manufacturer’s instructions and reverse transcribed using the SuperScript RT-PCR system (Invitrogen). The qRT-PCR for each gene was performed in three biological replicates using the KAPA SYBR FAST qPCR Kits (KAPA) and the expression value was quantified and normalized to the value of UBIQUITIN 7 [32 (link)]. Mean values and standard errors for each gene were calculated from three biological replicates. Primers are listed in Additional file 4 : Table S4.
10
Quantitative Analysis of Apelin and APJ Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from perirenal fat deposits and 3T3-L1 cells according to the
Trizol Reagent procedure (Invitrogen Life Technologies, Carlsbad, CA) and was subjected to
reverse transcription with a SuperScript RT-PCR system (Invitrogen). The resulting cDNA
was subjected to quantitative real-time PCR analysis with primers specific for apelin and
APJ (Table 1 Primers sequences used in quantitative real-time RT-PCR (M: mouse; R:<br/>rat)
System and Power SYBR® Green PCR Master Mix (Applied Biosystems, Foster City,
CA) as described [6 (link)]. Changes in gene expression
were normalized to 18sRNA and calculated by the 2–ΔΔCt method. All samples were
analyzed in triplicate.
Trizol Reagent procedure (Invitrogen Life Technologies, Carlsbad, CA) and was subjected to
reverse transcription with a SuperScript RT-PCR system (Invitrogen). The resulting cDNA
was subjected to quantitative real-time PCR analysis with primers specific for apelin and
APJ (
| Gene | GenBank No. | Forward primer | Reverse primer | Amplicon |
|---|---|---|---|---|
| (bp) | ||||
| Apelin (M) | NM_013912.3 | CGAGTTGCAGCATGAATCTGAG | TGTTCCATCTGGAGGCAACATC | 107 |
| APJ (M) | NM_011784.3 | GCATTATCGTGGTGCTTGTAGTGA | GCAAACTGCCCAGCATGTAGA | 87 |
| 18sRNA (M) | NM_011296 | TTCTGGCCAACGGTCTAGACAAC | CCAGTGGTCTTGGTGTGCTGA | 127 |
| Apelin (R) | NM_031612.2 | CAGGCCTATTCCCAGGCTCA | CAAGATCAAGGGCCCAGTCAA | 116 |
| APJ (R) | NM_031349.2 | CCTGGCTTGATGCAGTTGGA | TCTGGCCTGAGACATGCAGAG | 126 |
| 18sRNA (R) | NM_213557 | AAGTTTCAGCACATCCTGCGAGTA | TTGGTGAGGTCAATGTCTGCTTTC | 140 |
System and Power SYBR® Green PCR Master Mix (Applied Biosystems, Foster City,
CA) as described [6 (link)]. Changes in gene expression
were normalized to 18sRNA and calculated by the 2–ΔΔCt method. All samples were
analyzed in triplicate.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!