Hsa mir 223 3p

RT-qPCR was carried out as described above. Commercial LNA-enhanced primer assays for hsa-miR-223-3p, hsa-miR-199a-3p, hsa-miR-191-5p, hsa-miR-151a-5p, hsa-miR-148b-3p, hsa-miR-126-3p, and hsa-miR-21-5p (all Qiagen) were used. For each miRNA, 5′phosphorylated RNA oligos were synthesized (Table 2). The RNA mimics (IDT) were diluted corresponding to 10⁹ to 10³ copies/qPCR well and included in the RT reaction. The obtained Cq values within the linear range were used to fit a line to the data from each dilution series. Using the standards curves, raw Cq values from the samples were converted to copies/platelet or copies/μL plasma.

An MiRNeasy Serum/Plasma Kit (Qiagen) and miRNeasy Mini Kit (Qiagen, Hilden, Alemania) were used to extract the total RNA from the serum samples and the cells, respectively. An MiRNA specific Taqman MicroAssay (#4427975; ID 002619; Applied Biosystems) and Taqman miRNA Reverse Transcription Kit (Applied Biosystems) were used for reverse transcription. Specific primers used for all the microRNAs were obtained from Applied Biosystems [hsa-miR-16 (internal reference): upstream primer sequence 5′TAGCAGCACGTAAATATTGGCG3′; hsa-miR-223-3p: upstream primer sequence 5′TGTCAGTTTGTCAAATACCCCA3′;hsa-miR-765:upstream primer sequence 5′TGGAGGAGAAGGAAGGTGATG3′;hsa-miR-33b-3p:upstream primer sequence 5′CAGTGCCTCGG CAGTGCAGCCC3′; The downstream primer comes with the Qiagen kit]. These reactions were all carried out in duplicate in the 96-well plates, and the data were evaluated with the help of 7900HT Fast Real-Time PCR systems (Applied Biosystems).