Sybr green kit

The total RNA from tissues and cells was extracted using the Trizol reagent (AG, Beijing, China) and was reverse transcribed using the RT reagent kit (AG, Beijing, China). For mRNA, random and oligo (dT) primers were used to synthesize cDNA, and for miRNA, random and stem-loop primers were used to synthesize cDNA. The RT-qPCR assay was performed using the SYBR Green Kit (Vazyme, Nanjing, China) on the CFX96 System (Bio-Rad, Hercules, CA, USA). We applied β-actin and U6 as an internal control for the mRNA and miRNA. The quantitation data was analyzed by the 2^−ΔΔCt method, and each sample was replicated three times. All primers are listed in Table S1.

Total RNA was extracted from thyroid tissues by TRIzol (T9424, Sigma, USA) and phenol-chloroform. The concentration and purity of the extracted total RNA were subsequently determined using a Nanodrop 2000C spectrophotometer (Nano- Drop Technologies, USA), and samples with A260/A280 ranging between 1.8 and 2.0 were used in the experiments. Reverse transcription reactions were carried out by HiScript III All-in-one RT SuperMix Kit (R333, Vazyme, China). RT-qPCR amplifications were performed on 7500 Real-Time PCR System (Applied Biosystems, USA) using a SYBR Green Kit (Q711, Vazyme, China) according to the manufacturer´s instructions, and β-actin gene was used as an internal reference (forward, 5´-GCCGCCAGCTCACCAT-3´ and reverse, 5´-TCGTCGCCCACATAGGAATC-3´). The specific primers are as follows: INF-γ forward, 5´-AGTGATGGCTGAACTGTCGC-3´ and reverse, 5´-ACTGGGATGCTCTTCGACCT-3´; TNF-α forward, 5´-TCTCCTTCCTGATCGTGGCA-3´ and reverse, 5´-CAGCTTGAGGGTTTGCTACAAC-3´; IL1β forward, 5´-CCAGGGACAGGATATGGAGCA-3´ and reverse, 5´-TTCAACACGCAGGACAGGTACAG-3´.

Total mRNA was isolated from B16 cells using TRIzol reagent according to the supplier's instruction (Invitrogen, 15596018). Expression changes of genes were performed using HiScript II One Step quantitative real‐time polymerase chain reaction (qRT‐PCR) SYBR Green Kit (Vazyme, Q221‐01) with a reaction condition of reverse transcription at 50 °C for 15 min, initial denaturation at 95 °C for 5 min, and then 40 cycles of 95 °C for 10 s and 60 °C for 30 s on an CFX Connect Real‐Time System (Bio‐Rad, Hercules, CA, USA). The data were normalized against mouse GAPDH. The primer sequences were as follows: mouse GAPDH forward primer: 5′‐AGGTCGGTGTGAACGGATTTG‐3′ and reverse primer: 5′‐ TGTAGACCATGTAGTT‐GAGGTCA‐3′; mouse RARα forward primer: 5′‐TCAGTGCCATCTGCCTCATCT‐3′ and reverse primer: 5′‐ATGCTCCGAAGGTCTGTGATCT‐3′; mouse RARβ forward primer: 5′‐CTGCTTGCCTGGACATCCTAAT‐3′ and reverse primer: 5′‐CAGTCTCGGTGTCATCC‐ATCTC‐3′; mouse RARγ forward primer: 5′‐AATGCTGGCTTCGGTCCTCT‐3′ and reverse primer:5′‐ CCTGGCGGTCTCCACAGATTA‐3′.