Mastercycler ep realplex machine

To investigate the expression pattern of OsIRO3 in response to Fe deficiency, 2-week-old seedlings were exposed to solution without Fe for 1 week. Roots, shoots, and stems were sampled and subjected to RNA extraction. To further examine the expression pattern of different organs at different growth stages, different organs from plants grown in a paddy field were taken for RNA extraction.
For expression analysis of genes related to Fe homeostasis, WT and the iro3 mutants were grown in a nutrient solution with or without Fe for 4 d, roots were sampled and subjected to RNA extraction. Total RNA was extracted by using an RNA extraction kit (TaKaRa, Dalian, China). A cDNA Synthesis Kit (TaKaRa, Dalian, China) was used to synthesize first-strand cDNA. Quantitative RT-PCR was performed using the SYBR Green Supermix system on a Mastercycler ep realplex machine (Eppendorf, Germany). OsActin1 was used as the internal standard. The primers used for quantitative real-time PCR are listed in Table S1.

Using the RNAiso Plus reagent (Takara, China), total RNA was extracted from the leaves of three mulberry plants. M-MLV reverse transcriptase (Promega, Beijing, China) was used for the reverse transcription of RNA (1 g) into cDNA. Nine DEGs identified using transcriptome analysis were selected for qRT-PCR verification. qRT-PCR was performed on a Mastercycler^® ep realplex machine (Eppendorf, Hamburg, Germany). The reaction system included 0.5 μL primers, 1.0 μL cDNA, 5.0 μL 2 × SYBR Premix Go Taq (Promega, Beijing, China), and 3.5 μL DNase-free water. PCR parameters were as follows: 1 cycle of 5 min at 95 °C, followed by 40 cycles of denaturation for 15 s at 95 °C and annealing and elongation for 40 s at 60 °C. Melting curves were used to confirm specific qRT-PCR amplifications. The Actin 3 gene of mulberry (GenBank accession number HQ163775.1) was used as the internal control gene [34 (link)]. Primer Premier 5 was used to design primers for qRT-PCR, and the sequences are provided in the Supplementary Materials (Table S1). qRT-PCR experiments for all samples were performed in triplicate.

The transcriptional expression of fga, igl1c3, ERVL-7.2.48-DanRer, and ERVL-3.1.72-DanRer upon SVCV infection were determined by quantitative RT-PCR (Q-RT-PCR) on a Mastercycler ep realplex machine (Eppendorf). SVCV infection and RNA preparation were performed as described in RACE, and RNAs were reverse-transcribed into cDNAs. PCR experiments were performed in a total volume of 10 μL by using a SYBR Premix Ex Taq kit (TaKaRa Bio). The reaction mixtures were incubated for 2 min at 95°C, then subjected to 40 cycles of 15 s at 95°C, 15 s at 60°C, and 20 s at 72°C. The relative expression levels were calculated using the 2^−ΔCt and 2^−ΔΔCt method with β-actin for normalization. Each PCR trial was run in triplicate parallel reactions and repeated three times.

Subsequently, the qRT-PCR assays were performed on a Mastercycler ep realplex machine (Eppendorf, Hamburg, Germany) using TransStart^® Top Green qPCR SuperMix (AQ131, TransGen Biotech, Beijing, China). The qRT-PCR aliquot contained 1 μL cDNA, 0.4 μL of each forward and reverse primer (10 μM), 10 μL 2×TransStart^® Top Green qPCR SuperMix, and 8.2 μL RNase-free ddH2O and the reaction conditions were performed with an initial denaturation at 94 °C for 30 sec, followed by 40 cycles of denaturation at 94 °C for 5 sec, annealing at 55 °C for 15 sec, and extension at 72°C for 10 sec. Additionally, a melting curve was also produced for each sample at the end of each run to determine whether had the specificity of the amplified PCR product. The housekeeping gene G. hirsutum Actin (GhActin) was used as an internal control for data normalization, and the relative expression levels of circRNAs were calculated with the 2^−ΔΔCt method [80 (link)], as described in detail by our previous study [65 (link)]. To ensure the reliability of the assay data, all the results were obtained from three biological replicates and two technical repetitions. The circRNA-specific divergent primers for qRT-PCR were designed and synthesized commercially (BioSune Biotechnology, Shanghai, China), and are listed in Additional file 7: Table S5.

Total RNA from gastric cancer cells was isolated using TRIzol (Invitrogen, Carlsbad, CA, USA) and then reverse transcribed with PrimeScript RT Master Mix (Takara, Otsu, Japan). RT-PCR was conducted using an Eppendorf Mastercycler ep realplex machine (Eppendorf, Germany) and using SYBR Premix Ex Taq™ II Kit (Takara) according to the manufacturer’s instructions. The primers were as follows: CXCR7, forward (5′-TGGGTGGTCAGTCTCGT-3′) and reverse (5′-CCGGCAGTAGGTCTCAT-3′); CXCR4, forward (5′-CCTGAAGTACCCCATCGAGCAC-3′) and reverse (5′-ATACCCCCTCGTAGATGGGCACA-3′); GAPDH, forward (5′-GAAGGTGAAGGTCGGAGTC-3′) and reverse (5′-GAAGATGGTGATGGGATTTC-3′). Relative mRNA expression levels were calculated by the 2^-△△Ct method. GAPDH was used as a reference gene.

Total RNA was extracted from cell lines or frozen patient samples using TRIzol reagent (Invitrogen, Carlsbad, CA), and the first‐strand cDNAs were generated using PrimeScript RT master mix (Takara, Dalian, China) according to the manufacturer's protocol. Quantitative real‐time PCR (qPCR) was performed using FS Universal SYBR Green Master kit (Roche, Shanghai, China) on a Mastercycler ep realplex machine (Eppendorf, Germany). Cycling conditions were one cycle at 95°C for 10 minutes followed by 40 cycles of 95°C for 10 sec, 60°C for 5 sec, and 72°C for 10 sec. The fold change in the expression levels of RNF144A mRNA relative to housekeeping gene GAPDH was calculated based on the threshold cycle (C_t) as 2^−Δ(ΔCt)18, where ΔC_t = C_t (RNF144A) − C_t (GAPDH). The primer sequences were as follows: human RNF144A forward: CCACCTACAGGAGAACGAG, reverse: TCCGACAGGGATCAAACA; human GAPDH forward: CGAGATCCCTCCAAAATCAA, reverse: TTCACACCCATGACGAACAT.

Total RNA was extracted from cortical brain tissue using RNA Simple Total RNA Kit (TIANGEN Biotech Co. Ltd, China). The PCR was performed with equal amounts of cDNA in a Mastercycler ep realplex machine (Eppendorf, Germany). The relative gene expression levels were normalized to GAPDH.