In short, HEK293T cells were transfected with the psicheck2.0-DCX or NEUROD1-luc reporter constructs by helping with a DNA transfection reagent (Neofect, Beijing). Then, β-Amyloid (Aβ1-42, obtained from ChinaPeptides Co., Ltd. (QYAOBIO)) and GA (120μM) were added into the medium. After 24-h treatment, the cells were collected and rinsed using pre-cool PBS three times, followed by lysis with detection buffer (100μl firefly luciferase). A dual-Lumi dual luciferase reporter (DLR) gene assay kit (RG027) was applied for the luciferase activity assay of the cell extracts, which was purchased from Beyotime (Shanghai, China). The predicted ARE fragments (NRF2 binding site) on the promoter region of the gene DCX and NEUROD1 were cloned into the psicheck2.0 luciferase reporter vector (Promega, WI, USA). And the mutation site of ARE in luciferase plasmids was designed and constructed using the Gene Tailor system (Invitrogen, USA). Ahead of treatment with GA and Aβ, the cells were cultured in plates and transfected with constructs [31 (link)].
Genetailor system
Manufactured by Thermo Fisher Scientific
Sourced in United States
The GeneTailor system is a laboratory instrument designed for genetic engineering and molecular biology applications. It provides a platform for precise genome editing and modification, enabling users to introduce targeted changes in DNA sequences.
Automatically generated - may contain errors
7 protocols using genetailor system
1
Luciferase Assay for Amyloid-Beta and Ginkgolide A
2
Validation of c-Myc as a let-7d Target
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Based on analysis using miRwalk software (University of Heidelberg, Mannheim, Germany), c-Myc was predicted to be a direct target of let-7d. A 256-base fragment of the wild-type c-Myc 3’UTR with a let-7d binding site was amplified and then cloned into psiCHECK-2 vector (WT) containing XhoI and NotI restriction enzyme sites. Site-directed mutagenesis of the let-7d binding site in c-Myc 3’UTR was performed using a GeneTailor System (Invitrogen), and its cloning into psiCHECK-2 yielded the mutant-type vector MT. For reporter assays, WT, MT or control psiCHECK-2 vector were cotransfected into ovarian cancer cells with let-7d mimics or inhibitor. Luciferase activity was measured 48 h after transfection using a Dual-Luciferase Reporter Assay System (Promega Corporation, Madison, WI, USA).
3
Transcriptional Regulation by NRF2 Pathway
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Briefly, the P301S plasmid or vector, pNRF2‐Luc reporter construct and Renilla luciferase construct (pRL‐TK) were transfected into HEK293T cells using a Neofect DNA transfection reagent. After 24 h, cells were harvested and washed with precool PBS three times and lysed with firefly luciferase detection buffer (100 μl). The transfection efficiency of pRL‐TK was applied to normalize the activity of NRF2. Luciferase activity assay of cell extracts was performed in the DLR Assay System (Promega, WI, USA).
ARE fragments of the DLG2, DLG2 and SYN1 promoter were cloned into the pGL3 luciferase reporter vector (Promega, WI, USA). The mutation site of the pGL3‐DLG2/DLG4/SYN1 luciferase plasmids was constructed by the GeneTailor system (Invitrogen, USA). pGL3‐DLG2/DLG4/SYN1 luciferase plasmids were transfected into HEK293T cells using a Neofect DNA transfection reagent. An adequate quantity of HEK293T cells was cultured into cultured plates before transfection and then transfected with P301S or vector, pGL3 constructs and pRL‐TK plasmids. HEK293T cells were collected 24 h later and lysed with a firefly luciferase detection buffer (100 μl/well). The luciferase activity of each plasmid was determined using 20‐μl cell extracts in the DLR Assay System (Promega, WI, USA).
ARE fragments of the DLG2, DLG2 and SYN1 promoter were cloned into the pGL3 luciferase reporter vector (Promega, WI, USA). The mutation site of the pGL3‐DLG2/DLG4/SYN1 luciferase plasmids was constructed by the GeneTailor system (Invitrogen, USA). pGL3‐DLG2/DLG4/SYN1 luciferase plasmids were transfected into HEK293T cells using a Neofect DNA transfection reagent. An adequate quantity of HEK293T cells was cultured into cultured plates before transfection and then transfected with P301S or vector, pGL3 constructs and pRL‐TK plasmids. HEK293T cells were collected 24 h later and lysed with a firefly luciferase detection buffer (100 μl/well). The luciferase activity of each plasmid was determined using 20‐μl cell extracts in the DLR Assay System (Promega, WI, USA).
4
Generation of MoPrP Mutant Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The vector pUASTattB MoPrP was generated previously (Murali et al. 2014 (link)). To avoid the introduction of mutations into the pUASTattB (Bischof et al. 2007 (link)) targeting vector, the MoPrP insert was transferred as a BglII/XhoI restriction fragment into the cloning vector pCombo3 (Mike Scott, UCSF) and site-directed mutagenesis performed using the GeneTailor system (Invitrogen, Grand Island, NY) to create pCombo3 P101L, Q171R, and D177N MoPrP constructs. The P101L, Q171R, and D177N MoPrP inserts were then cloned into pUASTattB as BglII/XhoI fragments and the plasmid sequence confirmed by sequencing prior to phiC31-integrase-mediated insertion at attP2 and attP40 performed by Genetic Services, Inc. (Cambridge, MA). Isogenic lines carrying UAS-P101L, Q171R, and D177N MoPrP were isolated, balanced, and maintained using standard Drosophila genetic techniques.
5
Validating miR-4652-3p Regulation of HIPK2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The prediction software used predicted that HIPK2 is probably a direct target of miR-4652-3p. The 3′UTR fragment of HIPK2 was amplified using PCR primers and cloned into the psiCHECK-2 vector. Site-directed mutagenesis of the miR-4652-3p binding site at the HIPK2 3′UTR was performed using the GeneTailor system (Invitrogen). The wild (wt) or mutant (mt) type of the HIPK2 3′UTR vector, psiCHECK-2 were co-transfected into the cells with miR-4652-3p mimics or inhibitors. The tests were independently performed in triplicate using a dual luciferase assay kit (Promega Corp., Madison, WI, USA) according tothe manufacturer’s instructions.
6
Site-Directed Mutagenesis of MPGES1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Residues coordinating the GSH molecule; Asp49, Arg73, Arg126, and Ser127 were chosen for mutagenesis. The expression vector pSP19T7LT harboring the coding sequence for human MPGES1 [6 (link)] was subjected to site-directed mutagenesis using the GeneTailor™ system from Invitrogen (Stockholm, Sweden). The methylated plasmid DNA was amplified by polymerase chain reaction with two overlapping specific mutation primers. Plasmid DNA with the correct mutations, i.e. Asp49Ala, forward: 5' AAGGCCTTTGCCAACCCCGAGGCG ; Arg73Ala, forward: 5'-GAACGCTGCCTCAGGGCCCACGCG ; Arg73Leu, forward: 5'-GAACGCTGCCTCAGGGCCCACGAC ; Arg126Ala, forward: 5'-AAGCTGCGGGCACCCATCCGC ; Arg126Leu, forward: 5'-GGGAAGCTGCGGGCACCCATCGCG ; Ser127Ala, forward: 5'-GGGAAGCTGCGGGCACCCATCGACTCC ; were thereafter transformed into the E. coli DH5α-T1R-competent cells. DNA sequencing was used to confirm and verify the mutations and the insert sequence.
7
Site-Directed Mutagenesis of OBD Protein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
GeneTailor™ System (Invitrogen) was used to perform site-directed mutagenesis. The mutants were generated by replacement of Asp42 by Ala in the active site of OBD. DNA of plasmid pQE1-OBD (Boer et al., 2009 (link)), employed to overproduce OBD, was used as template in the mutagenesis reactions. Overlapping primers were designed following the manufacturer's specifications. The expected mutation was confirmed by DNA sequencing and the resultant mutant was purified as indicated below.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!