Pgl3 control firefly luciferase reporter vector

Vector encoding for praja2 was purchased from Genecopeia (Rockville, USA), all the deletion mutants and the RM were generated as previously described^{32 (link)}. AP2-HA vector was purchased from Genescript Biotech (New Jersey, USA). Myc tagged ubiquitin was previously described^{32 (link)}. SMART pool siRNA directed against different segments of praja2 coding sequence was purchased from Dharmacon. The following are the siRNA sequences (Thermo Scientific; LU-006916-00- 10) targeting human praja2:
sequence 1: 5′-GAAGCACCCUAAACCUUGA-3′;
sequence 2: 5′ -AGACUGCUCUGGCCCAUUU-3′;
sequence 3: 5′ -GCAGGAGGGUAUCAGACAA-3′;
sequence 4: 5′ -GUUAGAUUCUGUACCAUUA-3′.
The 3′-UTR region of praja2 gene, including binding site for miR-155, was amplified from HEK293 cells by using the following primers:
3′-UTR-XbaI-Fw CTAGTCTAGAGAGATCAGTGTATCAAAGTAAAT;
3′-UTR-XbaI-Rev CTAGTCTAGAGACTCCTTGACACTAACTGATC.
The amplified fragment was cloned into pGL3-Control firefly luciferase reporter vector (Promega) at the XbaI site. HEK293 cells were co-transfected with the pGCL3- Control firefly luciferase reporter vector with the praja2 3′UTR, the Renilla luciferase reporter plasmid and with the hsa-miR-155. Firefly and Renilla luciferase activities were measured 48 h after transfection with the Glomax luminometer microplate reader. Firefly activity was normalized to Renilla activity to control the transfection efficiency.

A dual luciferase reporter assay was performed as previously described to test whether miR-138 directly targets PKM2 [30 (link)]. In brief, the luciferase reporter gene constructs for PKM2 (pGL-PKM2) were generated by cloning the 3’-untranslated region (UTR) of PKM2 [NM_002654.5] containing the miR-138 binding site into the XhoI and NotI sites of a pGL-3-Control firefly luciferase reporter vector (Promega, Wisconsin, USA). The corresponding mutant construct (pGL-PKM2 m) was generated by replacing the seed regions of miR-138. These constructs were then verified by sequencing. The cells were transfected with the reporter constructs using Lipofectamine 2000 (Invitrogen, CA, USA). The pRL-TK vector (Promega, Wisconsin, USA) was also co-transfected and served as an internal control to normalize transfection efficiency. Luciferase activity was then determined using a GloMax 20/20 Luminometer (Promega, Wisconsin, USA).