Dnaiso reagent

The genome DNA were extracted from the tissue samples using DNAiso Reagent (TAKARA, Beijing, China). According to the nuclear and mitochondrial sequences of S.bungii species (GenBank accessions: AH001769.2 and MT767838.1), a set of PCR primers were separately designed for 18S rRNA, COX2, and Cytb: Spbu-18S-F (5′-GGA GAG CAA GAA TTA AGA-3′) and Spbu-18S-R (5′-TCG GTC AAT TCA CTC TAA-3′), Spbu-COX2-F (5′-TTA GTT AGA TGC TGT CAC-3′) and Spbu-COX2-R (5′-CAC AAA CAC TTC TCT TCC-3′), and Spbu-Cytb-F (5′-AAG TAC AGG ACG GTT AGA AC-3′) and Spbu-Cytb-R (5′-CTC CAT CTA ACC TGA ACG TC-3′). Each 40-μL reaction mixture contained 2 μL of template DNA (25–50 ng/μL), 20 μL of 2× Rapid Tap Master Mix (Vazyme, Nanjing, China), 1.5 μL of each primer (10 μM), and 15 μL H₂O. The PCR procedure consisted of pre-denaturation at 95 °C for 5 min, denaturation at 95 °C for 30 s, annealing at 50–55 °C for 30 s, extension at 72 °C for 40 s, 35 cycles, and a final extension at 72 °C for 5 min. Following agarose gel electrophoresis, the PCR products were sent to the Tsingke Biotechnology Co., Ltd. (Nanjing, China) for sequencing in one direction.

The total RNAs of the samples were extracted by using the RNAiso Plus (Takara, Japan) and the genomic DNAs of PCV2 were extracted with the DNAiso reagent (Takara, Japan) according to the manufacturer’s instructions. The extracted RNAs/DNAs were dissolved in 30 μL of nuclease-free water. RNA samples were stored at −80 °C and DNA samples were stored at −20 °C until use.

A pair of primers was designed to detect CPV-2. The forward primer was CTGTGGGTAATGTTGGTTGTT (5′ to 3′), and the reverse primer was TGGTCTTGATGTTGATGGATG (5′ to 3′). The expected product length was 1163 bp. We used DNAiso Reagent (TaKaRa, Beijing, China) to extract the viral genome and ExTaq DNA Polymerase (TaKaRa) to amplify the gene. The following amplification procedure was applied: initial denaturation at 94 °C for 5 min, then 35 cycles of denaturation at 94 °C for 30 s, annealing at 48 °C for 30 s and extension at 72 °C for 1 min. The final extension was performed at 72 °C for 7 min.

DNAiso Reagent (Takara Bio, Japan) was used to extract total DNA. After extraction, DNA Damage Quantification Colorimetric Kit (#K253-25, Bio Vision) was used to detect DNA damage quantification. All operation was performed according to the manufacturer’s instructions. Briefly, the Kit utilizes the ARP (Aldehyde Reactive Probe) reagent that reacts specifically with an aldehyde group which is the open ring form of the AP sites. After treating DNA containing AP sites with ARP reagents, AP sites are tagged with biotin residues, which can be quantified using avidin-biotin assay followed by a colorimetric detection.

Total DNAs were extracted from cells with DNAiso Reagent (TaKaRa, Dalian, China) following the manufacturer’s instruction. The quality of isolated genomic DNA was verified by using these two methods in combination: (1) DNA degradation and contamination were monitored on 1% agarose gels. (2) DNA concentration was measured by Qubit DNA Assay Kit in Qubit 2.0 Flurometer(Life Technologies, CA, USA). A total amount of 1μg DNA per sample was used as input material for the DNA library preparations. Sequencing library was generated using Truseq Nano DNA HT Sample Prep Kit (Illumina, USA) following manufacturer’s recommendations and index codes were added to each sample. Briefly, genomic DNA sample was fragmented by sonication to a size of 350 bp. Then DNA fragments were endpolished, A-tailed, and ligated with the full-length adapter for Illumina sequencing, followed by further PCR amplification. After PCR products were purified (AMPure XP system), libraries were analyzed for size distribution by Agilent 2100 Bioanalyzer and quantified by real-time PCR (3nM).
The clustering of the index-coded samples was performed on a cBot Cluster Generation System using Hiseq PE Cluster Kit (Illumina) according to the manufacturer’s instructions. After cluster generation, the DNA libraries were sequenced on Illumina Hiseq platform and 150 bp paired-end reads were generated.

Genomic DNA was extracted from the wings dissected from moths with DNAiso reagent (Takara) according to the manufacturer’s instructions. Concurrently, moths with wings dissected off were properly labeled and kept in a low-temperature refrigerator for later mating.
Sequences spanning the target site were amplified with the primers co-geno-F/R (S1 Table). The amplified PCR products were directly sequenced or subcloned into pMD19-T vectors (Takara, China). Clones were randomly chosen for Sanger sequencing to ascertain the mutated sequences.

Total RNA was isolated from homogenized gastrocnemius muscle using the RNeasy Fibrous Tissue Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The total RNA concentration was measured using a NanoDrop^® spectrophotometer (ND-1000, NanoDrop, Wilmington, DE, USA). The quality of the RNA was determined by assessing the A260/280 and A260/230 ratios and agarose gel electrophoresis.
Total DNA was isolated from homogenized gastrocnemius muscle using DNA iso reagent (Takara Bio, Shiga, Japan). Isolated DNA was dissolved in 0.5 mL Tris-EDTA buffer (Nippon Gene, Toyama, Japan). After ribonuclease digestion using RNase A (Takara Bio), ethanol precipitation was performed following the manufacturer’s instructions, and DNA was obtained. The quality of the DNA was determined by assessing the A260/280 and A260/230 ratios and agarose gel electrophoresis.