Probes master mix

Quantitative real-time PCR for caspase-1, IL-1β, IL-8, IL-18 and IL-6 was carried out with the LightCycler 480 instrument (Roche, Basel, Switzerland). Briefly, at 6, 18 and 24 h.p.i., total RNA was extracted using the RNeasy Plus Universal Tissue Mini Kit (Invitrogen, Carlsbad, CA, USA). RNA extracts were reverse transcribed using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Woburn, MA, USA), according to the manufacturer’s instruction. Primers and probes for each gene were added to the Probes Master Mix (Roche, Basel, Switzerland) at 500 and 250 nM, respectively, in a final volume of 20 μL. The housekeeping gene β-glucuronidase (GUS) was used as an internal control. GUS was selected as a good candidate for the housekeeping gene in our experimental setting, because it was constantly expressed in synovial cells after C. trachomatis or IFN stimulation. Gene expression values were calculated by the comparative 2−ΔCt methods. The primers and probe were assayed on demand and were purchased from Integrated DNA Technologies (IDT), Clear Creek, IA, USA. The list of primers and probes is as follows: IFNAR1: Hs.PT.58.20048943; IFNAR2: Hs.PT.58.1621113; IFNGR1: Hs.PT.58.20918191; IFNGR2: Hs.PT.58.38961914; IL-1β: Hs.PT.58.1518186; caspasi1: Hs.PT.59a.22997425.g; IL-6: Hs.PT.58.40226675; IL-18: Hs.PT.58.25675872; IL-8: Hs.PT.58.39926886.g.

Quantitative real-time PCR for IFN-α, IFN-β, and IFNR1 was carried out with the LightCycler 480 instrument (Roche, Basel, Switzerland). Briefly, total RNA was extracted from PBMCs and LPLs using the RNeasy Plus Universal Tissue Mini Kit (Invitrogen, Carlsbad, CA, USA) and reverse transcribed using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystem), according to the manufacturer's protocol. Primers and probes for each gene were added to the Probes Master Mix (Roche, Basel, Switzerland) at 500 and 250 nM, respectively, in a final volume of 20 μL. The housekeeping gene β-glucuronidase [14 (link)] was used as an internal control. Gene expression values were calculated by the comparative Ct method. The primers and probe sequences used for IFN-α (Hs. PT.58.24294810.g), IFN-β (Hs. PT.58.39481063.g), and IFNR1 (Hs. PT.58.25402720.g) were purchased from Integrated DNA Technologies (IDT), Iowa, USA.

Total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), according to the manufacturer's protocol. First-strand cDNA was synthesized with the Superscript III First-Strand Synthesis System (Invitrogen) using oligo dT primers. qRT-PCR was performed using the Light Cycler 480 (Roche; Mannheim, Germany) with Probes Master Mix (Roche). The primers were Trap (Mm00475698_m1), Ctr (Mm00432282_m1), Mmp9 (Mm00442991_m1), CatK (Mm00484039_m1), Rankl (Mm00441906_m1), Opg (Mm01205928_m1), Col1 (Mm00801666_g1), Alp (Mm00475834_m1), and Ocn (Mm03413826_mH) from Applied Biosystems (Foster city, CA, USA). The threshold cycle (Ct) value for each gene was normalized to the Ct value of 18S (Hs03928990_g1).

Gene expression was measured by quantitative PCR in a 5 μL reaction in a 384 well plate (Roche) comprising 2.5 μL Probes Master Mix (Roche) 0.125 μL of human target gene primer/probe, 0.125 μL of human calibrator gene primer/probe (GAPDH or B2M), 1.25 μL of PCR grade water and 1 μl of cDNA. The identities and sources of the primer/probe sets used are listed in Table 1. Thermocycling was performed in a Roche Light Cycler 480 II instrument using the following conditions: 95°C for 10 minutes, 95°C for 10s, 60°C for 30s for 55 cycles then 40°C for 30s. Relative gene expression was calculated using the equation 2^-ΔΔCT [27 (link)]. For screening the hits were called for individual plates. Compounds that stimulated >2-fold upregulation of TRIB1 over GAPDH expression and had the ΔΔCt ((TRIB1_DMSO Ct—GAPDH_DMSO Ct)-(TRIB_Cpd Ct—GAPDH_Cpd Ct)) Z-score <-2 and GAPDH Ct Z-score between 10 and-10 were considered hits. The Z-scores were calculated using standard deviations obtained for 32 DMSO treated wells present in each plate.

mRNA levels of IL-32α, IL-32nonα and MxA were assessed by real time RT-PCR using the LightCycler480 instrument, as previously described [17 (link)]. Briefly, total RNA was extracted from PBMC, CD4+ T lymphocytes and CD14+ monocytes using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA), according to the manufacturer's protocol. The purity of RNA was evaluated spectrophotometerically at the absorbance 230, 260 and 280 nm (Varioskan™ Flash Multimode Reader, Thermo Fisher Scientific Waltham, MA, USA). Cellular RNA was reverse transcribed by using High-Capacity cDNA Archive Kit (Applied Biosystems) as previously specified [22 (link)]. Primers and probes for each gene were added to the Probes Master Mix (Roche, Basel, Switzerland) at 500 and 250 nM respectively, in a final volume of 20 μl. The housekeeping gene β-glucuronidase was used as an internal control. The primers and probe sequences used for β-glucuronidase gene were the following: Forward 5′-TCTGTCAAGGGCAGTAACCTG-3′, Reverse 5′-GCCCACGACTTTGTTTTCTG-3′, Probe 5′-(6FAM)TATGTCTTTCGATATGCAGCCAAGTTTTACCG3′(TAM)-3′. Gene expression values were calculated by the comparative Ct method. In particular, data were analyzed using the equation 2^−deltaC_T, where DeltaC_T = (C_T of target gene − C_T of housekeeping gene).