Total RNA was extracted from cultured cells at 80% confluence using TRIzol® (Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. cDNA synthesis was carried out using SuperScript II Reverse Transcriptase and random hexanucleotide primers (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocols. qPCR was performed using synthesized primers (Tsingke Biological Technology) and SYBR green master mix (Tiangen Biotech Co., Ltd.) to detect the mRNA levels. PCR conditions were as follows: Pre-denaturation at 95°C for 1 min; followed by 40 cycles of denaturation at 95°C for 20 sec, annealing at 60°C for 20 sec and elongation at 72°C for 30 sec. The reaction was performed using an Applied Biosystems 7500 Fast Sequence Detection system (Applied Biosystems; Thermo Fisher Scientific, Inc.). The expression levels of the target genes were quantitated using the 2−ΔΔCq method and β actin (ACTB) was used as the internal control to normalize the qPCR data (28 (link)). The primer sequences are presented in Table II . All samples were examined at least three times.
Applied biosystems 7500 fast sequence detection system
Manufactured by Thermo Fisher Scientific
Sourced in United States
The Applied Biosystems 7500 Fast Sequence Detection System is a real-time PCR system designed for quantitative gene expression analysis and genotyping applications. It provides fast thermal cycling and precise temperature control to enable rapid, reliable results.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy mini kit, by Qiagen (4 mentions)
Trizol, by Thermo Fisher Scientific (3 mentions)
Superscript first strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Random hexanucleotide primers, by Thermo Fisher Scientific (1 mentions)
Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Sybr green master mix, by Tiangen Biotech (1 mentions)
Mirneasy mini kit, by Qiagen (1 mentions)
Oligo dt, by Promega (1 mentions)
Gapdh, by Thermo Fisher Scientific (1 mentions)
Superscript 3, by Thermo Fisher Scientific (1 mentions)
Taqman fast universal pcr master mix, by Thermo Fisher Scientific (1 mentions)
Taqman microrna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Taqman gene expression master mix, by Thermo Fisher Scientific (1 mentions)
Sybr green reagent, by Qiagen (1 mentions)
M mlv reverse transcriptase kit, by Takara Bio (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Spss version 18, by IBM (1 mentions)
Quantitect sybr green pcr master mix, by Qiagen (1 mentions)
Superscript first strand cdna synthesis system, by Thermo Fisher Scientific (1 mentions)
Reverse transcription kit, by Promega (1 mentions)
9 protocols using applied biosystems 7500 fast sequence detection system
1
Quantitative RT-PCR Protocol for Gene Expression
2
Quantitative Analysis of miR-221/222 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from prefrontal cortex of mice and cultured cells using an RNeasy mini kit or miRNeasy mini kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s instruction. MiR-221/222 expressions were measured by quantitative real-time PCR (qRT-PCR) using an Applied Biosystems 7,500 Fast Sequence Detection System (Applied Biosystems Inc., Carlsbad, CA, USA) and genespecific Taqman assay kits (Applied Biosystems Inc.). GAPDH and U6 expression were served as loading controls for Cx43 and miR-221/222, respectively. The primers of miR-221/222 and Cx43 are listed in Table 1 and 2 . Cycling conditions were as follows: 95°C for 10 min and 40 cycles of 15 s at 95°C and 60 s at 60°C.
3
Quantification of Cytokine Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The levels of gene expression for cytokines were determined by real-time PCR using the Applied Biosystems 7500 Fast Sequence Detection System (Applied Biosystems, Foster City, CA, USA). Briefly, total RNA from BM cells and cultured stromal cells was isolated using ISOGEN reagent (Nippongene Corp., Toyama, Japan). mRNA was reverse transcribed using Superscript III (Life Technologies, Carlsbad, CA, USA) and oligo-dT (Promega Corp., Madison, WI, USA). The transcript levels were determined by real-time PCR using TaqMan™ Universal Fast PCR master mix (Applied Biosystems) and gene-specific primers. Specific primers and probes for the murine genes encoding granulocyte colony-stimulating factor (G-CSF), GM-CSF, interleukin (IL)-6, IL-7, stromal-cell derived factor-1 (SDF-1), stem cell factor (SCF), tumor necrosis factor-α (TNF-α), transforming growth factor-β (TGF-β), p16INK4a, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were as described elsewhere21 (link)–23 (link) and were purchased from Applied Biosystems.
4
Quantitative Analysis of miRNA-27a
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
miRNAs from cultured MCs and kidney glomeruli were isolated using the E.Z.N.A. miRNA Kit (Sigma, USA). cDNA was synthesized using miRNA-specific reverse transcription primers and the TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems, USA). miRNA-27a expression was quantified using miRNA-specific PCR primers and probe and the TaqMan Gene Expression Master Mix (Applied Biosystems, USA) on an Applied Biosystems 7500 Fast Sequence Detection System (Applied Biosystems). U6 small nuclear RNA (snRNA) served as an internal control and was amplified with forward (5′-ATTGGAACGATACAGAGAAGATT-3′) and reverse (5′-GGAACGCTTCACGAATTTG-3′) primers, and detected with a probe (5′-TGCGCAAGGATGACACGCA-3′). All primers and probes were obtained from GenePharma (Shanghai, PRC). Each sample was run in triplicate, and each experiment was repeated at least 3 times. Relative expression of miR-27a was analysed using the 2−ΔΔCT method23 (link).
5
Quantifying Gene Expression via RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Reverse transcription PCR was performed on an Applied Biosystems ® 7500 fast sequence detection system (Applied Biosystems; Thermo Fisher Scientific, Inc.). Briefly, total RNA was extracted using TRIzol ® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) and reverse transcribed using the MMLV Reverse Transcriptase kit (Takara Biotechnology Co., Ltd., Dalian, China) according to the manufacturer's protocol. qPCR was performed using SYBR Green reagent (Qiagen, Inc., Valencia, CA, USA). Cycling conditions were as follows: An initial predenaturation step at 95˚C for 5 min, followed by 40 cycles of denaturation at 95˚C for 15 sec, annealing at 58˚C for 30 sec and extension at 72˚C for 20 sec. The experiment was performed three times. The relative expression levels of the target genes were calculated using the 2 -∆∆Cq method (17) and normalized to GAPDH. Forward and reverse sequences of the primers used for all target genes and GAPDH are listed in Table I.
Statistical analysis. Data are expressed as the mean ± standard deviation. Comparisons between two groups were analyzed by unpaired Student's t-test. Experiments were repeated three times. P<0.05 was considered to indicate a statistically significant difference analyzed using SPSS version 18.0 (SPSS, Inc., Chicago, IL, USA).
Statistical analysis. Data are expressed as the mean ± standard deviation. Comparisons between two groups were analyzed by unpaired Student's t-test. Experiments were repeated three times. P<0.05 was considered to indicate a statistically significant difference analyzed using SPSS version 18.0 (SPSS, Inc., Chicago, IL, USA).
6
Quantitative RT-PCR Analysis of SOX11 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cultured cells using the RNeasy mini kit (Qiagen) and cDNA was synthesized with oligo(dT) primers by using a SuperScript first-strand cDNA synthesis kit (Invitrogen) according to the manufacturer’s protocols. Gene expression was assessed by qRT-PCR using an Applied Biosystems 7500 Fast Sequence Detection System (Life Technologies Corp., CA, USA). The PCR reaction mixture consisted of QuantiTect SYBR Green PCR master mix (2X QuantiTect SYBR Green kit, contains HotStart Taq® DNA polymerase, QuantiTect SYGB Green PCR buffer, dNTP mix, SYGB I, Rox passive reference dye and 5 mM MgCl2) (Qiagen), 0.5 μmol/l of each primer and cDNA. The transcript of the housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene was used as endogenous control to normalize expression data. Primers used for qRT-PCR analysis of SOX11 expression are 5′-GGTGGATAAGGATTTGGATTCG-3′ (forward) and 5′-GCTCCGGCGTGCAGTAG T-3′ (reverse). Primers used for analysis of GAPDH are 5′-TTGGCATCGTTGAGGGTCT-3′ (forward) and 5′-CAGTGGGAACACGGAAAGC-3′ (reverse). The comparative Ct (threshold cycle) method was used to calculate the relative changes in gene expression.
7
Quantifying CLDN1 Gene Expression in Cultured Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cultured cells using the RNeasy mini kit (Qiagen, GER) and cDNA was synthesized with oligo (dT) primers by using of a SuperScript first-strand cDNA synthesis kit (Invitrogen, USA) according to the manufacturer's protocols. Gene expression was assessed by qRT-PCR using an Applied Biosystems 7500 Fast Sequence Detection System (Life Technologies Corporation, CA, USA). The transcript of the housekeeping gene, Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene was used as endogenous control to normalize expression data. Primers used for qRT-PCR analysis of CLDN1 expression are 5′- GCCCTGCCCCAGTGGAGGAT -3′ (forward) and 5′- CGGGTTGCTTGCAATGTGCTGCT -3′ (reverse). Primers used for analysis of GAPDH are 5′-TTGGCATCGTTGAGGGTCT-3′ (forward) and 5′-CAGTGGGAACACGGAAAGC -3′ (reverse). The comparative Ct (threshold cycle) method was used to calculate the relative changes in gene expression.
8
Gene Expression Analysis by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cultured cells using an RNeasy mini kit (Qiagen, Hilden, Germany); complementary DNA (cDNA) was prepared from 1 μg total RNA with oligo (dT) primers using a SuperScript First-Strand cDNA Synthesis System (Invitrogen, Carlsbad, CA) according to the manufacturer's protocols. CDNA (10 ng) was used as the template for qRT-PCR using an Applied Biosystems 7500 Fast Sequence Detection System (Life Technologies Corporation, Carlsbad, CA). Relative mRNA expression was calculated from the comparative threshold cycle (ΔCt), and normalized to 18S rRNA. The primers used are listed in Table 1 . All experiments were performed at least three times, each in triplicate.
9
Gene Expression Analysis by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with Trizol (Invitrogen) and cDNA was synthesized with a reverse transcription kit (Promega, WI, USA) according to the instructions. QRT-PCR was performed using SBGREEN PCRmaster mix (ABI, FL, USA) and detected by Applied Biosystems 7500 fast sequence detection system (Life Technologies Corporation, CA, USA). GAPDH was used as an internal reference. The relative expression of genes was evaluated by the value of relative CT (threshold cycle), and the relative expression level of mRNA was calculated by 2-ΔCT. The primers were as followed: TRIM22: 5′-CTTTATGGCTGTGCCTCCC-3′ (fwd) and 5′-GTAGATGAGTGCTCCGTGGTT-3′ (rev), HSPA6: 5′-GAGGTGGAGAGGATGGTTCA-3′ (fwd) and 5′-TGTCCTCTTCGGGAATCTTG-3′ (rev), SRARP: 5′-CGTGTTCTGTGGGGAAAACT-3′ (fwd) and 5′- GGGCTTTCAGTGAGTCCTTG-3′ (rev), RAD51AP1: 5′-GACTTCGGTGGACTCTGCTC-3′ (fwd) and 5′-CGGAGACTCTGATTGGGAGA-3′ (rev), GAPDH: 5′-TTGGCATCGTTGAGGGTCT-3′ (fwd) and 5′- CAGTGGGAACACGGAAAGC-3′ (rev).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!