Total RNA was reverse transcribed to cDNA by using TOOLS Easy Fast RT kit (Biotools, Taipei, Taiwan) according to manufacturer's instructions. qPCR was performed using the CFX Connect Real‐time qPCR Detection System (Bio‐Rad) with Applied Biosystems™ Power SYBR™ Green PCR Master Mix (Thermo Fisher Scientific). The primer sequences used for quantitative qPCR analysis is attached in TableS1 .
Cfx connect real time qpcr detection system
Manufactured by Bio-Rad
Sourced in China
The CFX Connect Real-time qPCR Detection System is a laboratory instrument designed for real-time quantitative PCR (qPCR) analysis. It is capable of detecting and quantifying targeted DNA sequences in real-time.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Foregene (2 mentions)
Sybr green real time qpcr master mix, by Foregene (2 mentions)
Applied biosystems power sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Takara Bio (1 mentions)
Revertaid first strand cdna synthesis kit, by Takara Bio (1 mentions)
4 protocols using cfx connect real time qpcr detection system
1
Reverse Transcription and qPCR Analysis
2
Quantifying Fat Metabolism Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To measure the expression of fat metabolism‐related genes at the mRNA level, total RNA was isolated from the liver, abdominal adipose tissue, breast muscle and leg muscle with TRIzol reagent (Takara, Japan) according to the manufacturer’s instructions. The cDNA was synthesized using the RevertAid First‐Strand cDNA Synthesis Kit (Takara, Japan). The reaction mixture (10 μl) for qPCR contained 5 μl of SYBR Select Master Mix for CFX (Takara, Japan), 0.4 μl of each forward and reverse primer, 3.2 μl of ddH2O and 1 μl of template cDNA. The qPCR reactions were performed on a Bio‐Rad CFX Connect real‐time qPCR detection system (Bio‐Rad, Hercules, CA, USA).
The qPCR conditions were as follows: pre‐denaturation at 95 °C for 5 min, followed by 40 cycles of denaturation at 95 °C for 30 s, annealing at 60 °C for 30 s and elongation at 72 °C for 20 s. The primer sequences are listed in Table1 . β‐Actin was chosen as a reference for qPCR. All samples were run in triplicate, and gene expression levels were quantified using the ΔΔCt method.
The qPCR conditions were as follows: pre‐denaturation at 95 °C for 5 min, followed by 40 cycles of denaturation at 95 °C for 30 s, annealing at 60 °C for 30 s and elongation at 72 °C for 20 s. The primer sequences are listed in Table
3
Quantifying H19 and miR-29 Expression in Renal Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from renal tissue or HMVECs using Trizol reagent (Foregene, Chengdu, China). Reverse transcription was performed using the Premix RT EasyTM II (With gDNase) (Foregene, Chengdu, China). All qPCR experiments were performed using SYBR Green real time qPCR Master Mix (Foregene, Chengdu, China) on a Bio-Rad CFX Connect Real Time qPCR Detection system (Bio-Rad Laboratories, Inc.). For the qPCR reactions, two ul cDNA was added to a 20 µl reaction mixture containing 10 µl of 2 × Power SYBR Green qPCR Master Mix with 0.8 µl of each primer. The comparative Ct method was used to detect target gene expression in the test samples relative to control samples. All primers were synthesized by RIBOBIO (Guangzhou, China). 18S RNA level was used as a reference. The primers sequences: H19: 5’-AAGCAGATGGAACAGGTGGC-3’ (forward) and 5’-CACAGCCAAACTGCCCAAAG-3’ (reverse); miR 29s: miR-29a-3p: 5 -UAGCACCAUCUGAAAUCGGUUA, miR-29b-3p: 5i UAGCACCAUUUGAAAUCAGUGUU, miR-29c-3p: 5 UAGCACCAUUUGAAAUCGGUUA.
4
Quantitative Analysis of miR-101-3p Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from renal tissue or cells using Trizol reagent (Foregene, Chengdu, China). Reverse transcription was performed using the Premix RT EasyTM I (Foregene, Chengdu, China). The SYBR Green real-time qPCR Master Mix (Foregene, Chengdu, China) on a Bio-Rad CFX Connect Real-Time qPCR Detection system (Bio-Rad Laboratories, Inc.) was used to perform RT-qPCR following with the manufacturer’s instructions. The comparative CT method was used to detect target gene expression in the test samples relative to control samples. The primers were synthesized by RIBOBIO (Guangzhou, China). U6 RNA level was used as a reference. The primers sequences were miR-101-3p: TACAGTACTGTGATAACTGAA (forward) and GCAGGGTCCGAGGTATTC (reverse); U6: CGCAAGGATGACACGCAAAT (forward) and GCAGGGTCCGAGGTATTC (forward), respectively.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!