[γ–32P]-ATP was purchased from MP Biomedical (Irvine, CA, USA). Unlabeled deoxynucleoside triphosphate (dNTPs) (ultrapure) were obtained from Pharmacia. Unlabeled dNTPs (ultrapure) were obtained from Pharmacia. Magnesium acetate, magnesium chloride and Trizma base were from Sigma. Urea, acrylamide and bis-acrylamide were from National Diagnostics (Rochester, NY, USA). Oligonucleotides, including those containing 8-oxo-guanine, were synthesized by Operon Technologies (Alameda, CA, USA). All modified nucleotides including N6-MedATP, 6-Cl-PTP, 6-Cl-2APTP, O6-MedGTP, N2-MedGTP, 2-6-dATP, dITP and 8-oxo-dGTP were obtained from Trilink Biotechnologies (San Diego, CA, USA). All non-natural nucleotides including IndTP, 5-MeITP, 5-Et-ITP, 5-EyITP, 5-NITP, 4-NITP and 6-NITP were synthesized and purified as previously reported (23 (link)–26 (link)). All other materials were obtained from commercial sources and were of the highest available quality. Exonuclease-deficient bacteriophage T4 DNA polymerase (gp43exo− (Asp-219 to Ala mutation)) was purified and quantified as previously described (27 (link)). Recombinant human polymerase delta (pol δ) and human polymerase eta (pol η) were purified as previously described (28 (link),29 (link)). All DNA polymerases used in this study were >97% pure as assessed by sodium dodecylsulphate-polyacrylamide denaturing gel electrophoresis.
Urea
Manufactured by National Diagnostics
Sourced in United States
Urea is a key laboratory test used to measure the amount of urea nitrogen in the blood. Urea is a waste product formed when proteins are broken down in the body. It is primarily filtered out by the kidneys and excreted in urine. The urea test helps healthcare providers evaluate kidney function and identify potential issues related to kidney disease or other conditions.
Automatically generated - may contain errors
Lab products found in correlation
Magnesium acetate, by Merck Group (1 mentions)
Acrylamide, by National Diagnostics (1 mentions)
Bis acrylamide, by National Diagnostics (1 mentions)
Magnesium chloride, by Merck Group (1 mentions)
Trizma base, by Merck Group (1 mentions)
γ 32p atp, by MP Biomedicals (1 mentions)
8 oxo dgtp, by TriLink (1 mentions)
Elutrap, by Cytiva (1 mentions)
Turbo dnase, by Thermo Fisher Scientific (1 mentions)
2 protocols using urea
1
Synthesis and Purification of Modified Nucleotides
2
In Vitro Transcription of Small RNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmids carrying 9S and RprA genes were provided by A.J. Carpousis and K. Papenfort, respectively. Forward PCR primers were designed in a way to add promoter sequence recognized by T7 RNA polymerase. PCR products were used as In Vitro Transcription (IVT) templates. IVT was carried out according to standard protocol with addition of 3% DMSO (v/v), followed by DNA template digestion with TURBO DNase (Thermo Fisher). For synthesis of 5′ monophosphorylated RNA, five-fold excess of rAMP or rGMP over rATP or rGTP was used for RprA and 9S respectively to cap the product (Bandyra et al., 2012 (link)). Synthesized RNAs were purified on 4% (9S) or 6% (RprA) polyacrylamide gel containing 7.5 M urea (National Diagnostics). The bands were visualized with UV shadowing and excised, and RNAs were eluted from gel slices by overnight electroelution (100V, EluTrap, Whatman). The ompD RNA was prepared as previously described (Bandyra et al., 2012 (link)).
Primers used for IVT template preparation
| Primer name | Sequence 5′ → 3′ | |
| RprA | For | GTTTTTTTTTTAATACGACTCACTATTACGGTTATAAATCAACACATTG |
| Rev | AAAAAAAAGCCCATCGTAGGAG | |
| 9S | For | GTTTTTAATACGACTCACTATAGAAGCTGTTTTGGCGGATGAGAG |
| Rev | CGAAAGGCCCAGTCTTTCGACTGAGC | |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!