Urea
Urea is a key laboratory test used to measure the amount of urea nitrogen in the blood. Urea is a waste product formed when proteins are broken down in the body. It is primarily filtered out by the kidneys and excreted in urine. The urea test helps healthcare providers evaluate kidney function and identify potential issues related to kidney disease or other conditions.
Lab products found in correlation
2 protocols using urea
Synthesis and Purification of Modified Nucleotides
In Vitro Transcription of Small RNAs
Primers used for IVT template preparation
Primer name | Sequence 5′ → 3′ | |
RprA | For | GTTTTTTTTTTAATACGACTCACTATTACGGTTATAAATCAACACATTG |
Rev | AAAAAAAAGCCCATCGTAGGAG | |
9S | For | GTTTTTAATACGACTCACTATAGAAGCTGTTTTGGCGGATGAGAG |
Rev | CGAAAGGCCCAGTCTTTCGACTGAGC |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!