Absolute blue qpcr sybr green mix

Total RNA was prepared using RNeasy plus Kit (QIAGEN). cDNA was generated by the Verso cDNA synthesis Kit (Thermo Scientific) with random hexamer primers. Real-time PCR assays were performed with Absolute Blue qPCR SYBR green Mix (Thermo Scientific) or Taqman Universal Master Mix II (Applied Biosystems, for GATA1-FL and GATA1-S) on a ViiA 7 system (Applied Biosystems). Primers are listed in Supplementary file 2. GAPDH was used as an internal control for normalization. Relative expression level was calculated by ∆(∆ct) method and all results were expressed as mean values ± standard errors from at least three independent experiments.
GATA1 isoforms can be detected by regular PCR reactions with the primers: GATA1 Ex1 F: ATCACACTGAGCTTGCCACA, GATA1 Ex3 R: AGCTTGGGAGAGGAATAGGC in Figure 5H.

Tissue preparations were performed as follows: For the time series analysis, brains were removed and placed into a cooled brain matrix (Zivic Instruments, Pittsburgh, PA). Perilesional brain tissue was dissected and immediately frozen in liquid nitrogen. For the 24-h and the 5-day studies perilesional brain tissue was collected during the cryosectioning process. Tissue was stored at −80°C until RNA isolation. Samples were homogenized in QIAzol® reagent (Qiagen). RNA isolation was performed with RNeasy® Lipid Tissue Mini kit (Qiagen) according to manufacturer's instructions. Absolute copy numbers of target genes were normalized against the housekeeping gene cyclophilin A (PPIA) (Thal et al., 2008 (link)). For applied primer sequences see Table 2. Same amounts of cDNA were amplified in duplicates using Absolute Blue qPCR SYBR Green Mix (Thermo fisher Scientific) for Ppia, Tnf-α, inos, and Sqstm1, Maxima Probe qPCR Mastermix (Thermo Fisher Scientific) for Il-1β and Bag3, Light Cycler 480 Probes Master (Roche) for Bag1, and Quanti Nova qPCR kit (Qiagen) for IL-6 according to the manufacturer's instructions.

Total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and cDNA was synthesized using iScript (Biorad, Life Science Research, Hercules, CA, USA). For p21 amplification, primers p21-F (5′-TGA GCC GCG ACT GTG ATG-3′) and p21-R (5′-GTC TCG GTG ACA AAG TCG AAG TT-3′) were used.
For HSRP amplification, primers HSRP-F (5′-AGC CTC AAG ATC ATC AGC AAT G-3′) and GAPDH-R (5′-ATG GAC TGT GGT CAT GAG TCC TT-3′) were used.
To determine p21 mRNA levels and stability, quantitative RT-PCR was performed on a Mastercycler^® ep Realpex (Eppendorf, Hauppauye, NY, USA) using a total volume of 20 μl containing 200 nM primers and 1X Absolute^™ Blue QPCR SYBR^® Green Mix (ABgene, Thermo Fisher Scientific, Rockford, IL, USA).