VHH DNA library containing a specified amount of diversity was first amplified using a DNA recovery primer pair listed in table S3 . Equal mixtures of Phusion DNA polymerase (New England Biolabs, M0530L) and Deep Vent DNA polymerase (New England Biolabs, M0258L) were used for the PCR. PCR cycle number was chosen to avoid over-amplification and typically falls between 5 and 15. In a standard preparation, 200–500 ng of the purified PCR product was used as DNA template in 25 μl of coupled in vitro transcription and translation reaction using PURExpress In Vitro Protein Synthesis Kit (New England Biolabs, E6800L). The reaction was incubated at 37°C for 30 minutes, then placed on ice, and 200 μl ice cold stop buffer (10 mM HEPES pH 7.4, 150 mM KCl, 2.5 mM MgCl2, 0.4 μg/μl BSA (New England Biolabs, B9000S), 0.4 U/μl SUPERase•In (ThermoFisher Scientific, AM2696), 0.05% TritonX-100) was then added to stop the reaction. This stopped ribosome display solution was used for binding to immobilized protein targets during in vitro selection. The amount of DNA template, volume of coupled in vitro transcription and translation reaction, and volume of stop buffer were scaled proportionally when different volumes of stopped ribosome display solution was needed. 1 to 8X standard preparations were used for each selection cycle.
Deep vent dna polymerase
Manufactured by New England Biolabs
Sourced in United Kingdom
Deep Vent DNA polymerase is a thermostable DNA polymerase enzyme isolated from the hyperthermophilic marine archaeon Pyrococcus species GB-D. It is capable of performing high-fidelity DNA amplification and extension at elevated temperatures.
Automatically generated - may contain errors
Lab products found in correlation
T4 dna ligase, by New England Biolabs (2 mentions)
Bamhi, by New England Biolabs (2 mentions)
Superase in, by Thermo Fisher Scientific (1 mentions)
Bovine serum albumin (bsa), by New England Biolabs (1 mentions)
Purexpress in vitro protein synthesis kit, by New England Biolabs (1 mentions)
Phusion dna polymerase, by New England Biolabs (1 mentions)
Thermopol reaction buffer, by New England Biolabs (1 mentions)
Deep vent polymerase, by New England Biolabs (1 mentions)
Amylose resin, by New England Biolabs (1 mentions)
Freund s complete and incomplete adjuvant, by Merck Group (1 mentions)
Tricine, by Merck Group (1 mentions)
Factor xa, by New England Biolabs (1 mentions)
Biotin n hydroxysuccinimide ester, by Merck Group (1 mentions)
Isopropyl thiogalactoside iptg, by Merck Group (1 mentions)
Oligonucleotide, by Merck Group (1 mentions)
Protein a sepharose, by Merck Group (1 mentions)
Gelatin, by Merck Group (1 mentions)
Triton x 100, by Merck Group (1 mentions)
3 3 diaminobenzidine (dab), by Merck Group (1 mentions)
Pneb193 vector, by New England Biolabs (1 mentions)
13 protocols using deep vent dna polymerase
1
Ribosome Display Protocol for Protein Selection
2
Overlap Extension Mutagenesis of CVB3 CRE(2C)
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mutations in the CVB3 CRE(2C) were generated using overlap extension mutagenesis (49 (link)). Two overlapping fragments of CVB3 cDNA were generated from the infectious cDNA clone of CVB3/28 (48 (link)) by PCR using Deep Vent DNA polymerase (New England BioLabs, Ipswich, MA) and the primer pair ID13 and CREKORev or CREKO and XBA (Table 1 ) with 4 mM MgSO4 and 200 μM deoxynucleoside triphosphates (dNTPs). Cycling was carried out as noted in Table 2 with modified cycle denaturation and annealing times of 30 s each. The two amplimers were gel purified, combined in Thermopol reaction buffer [20 mM Tris-HCl, 10 mM (NH4)2SO4, 10 mM KCl, 4 mM MgSO4, 0.1% Triton X-100, pH 8.8; New England BioLabs] with 200 μM dNTPs, and repeatedly denatured and annealed 10 times (1 min at 94°C, 50°C for 1 min), followed by extension with Deep Vent polymerase (2,000 U/ml) at 72°C for 2 min. The mutated overlap extension product was subsequently directly amplified using the ID13 and XBA primers (Tables 1 and 2 ) and Deep Vent polymerase with the modified denaturation and annealing times described above. The amplified product of this reaction was digested with BssH2 and XbaI and then ligated with the BssH2-XbaI restriction fragment of pCVB3 or pCVB3-TD50 (25 (link)) to produce pCVB3-CKO and pCVB3-TD50-CKO, respectively.
3
Recombinant Protein Expression and Purification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Oligonucleotides were custom-synthesized by Sigma-Aldrich (Bengaluru, India). Deep-vent DNA polymerase, plasmid pMAL-c4X, Bam H1 and Eco R1 restriction enzymes, T4 DNA ligase, amylose resin, factor Xa, and EK12 cells were purchased from New England Biolabs (Hitchin, Hertfordshire, UK). Isopropyl thiogalactoside (IPTG), avidin-peroxidase, 3,3'-diaminobenzidine, gelatin, tricine, triton X-100, biotin N-hydroxysuccinimide ester, protein A-Sepharose, polyvinylidine difluoride (PVDF) membrane, Freund's Complete and Incomplete Adjuvants were procured from Sigma Aldrich (Bengaluru). Centrifugal concentrator units were purchased from Sartorius (Gottingen, Germany). All other reagents used were of analytical grade and obtained locally. CSF samples were collected into sterile tubes and placed on ice, and within 1 h of collection, frozen and preserved at −80°C until analyses were obtained from the archives of the Human Brain Tissue Repository (HBTR), NIMHANS. This study was approved by the Institutional Human Ethics Committee.
4
Inducible Mammalian FLAG-α-Syn Expression
5
Cloning and Mutagenesis of Zebrafish Urate Oxidase
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A cDNA encoding the complete sequence of zebrafish urate oxidase (IMAGE:100059545) was PCR-amplified using a high fidelity thermostable DNA polymerase (Deep Vent DNA polymerase, New England Biolabs) and two sequence-specific primers: an upstream primer (5′-CATATGGCCACTACCTCAAATC-3′) and a downstream primer (5′-GGATCCTTGTCTTCACATTCTG-3′). The amplification product cloned into pNEB193 vector (New England Biolabs) was digested with BamHI and NdeI and subcloned into the expression vector pET11b. The urate oxidase mutant F216S was obtained by site-directed mutagenesis using a high fidelity thermostable DNA polymerase (Pfu Ultra II Fusion HS DNA polymerase, Stratagene) and the primer 5′-CCGTCATTCAAAAGTC TGCAGGACCCTACGATCG-3′ and its reverse complementary. The plasmid pET11b-DrUox was used as template and the reaction products were treated with DpnI (Stratagene) to digest the parental DNA template. For the production of His-tagged proteins, the sequences encoding DrUox wild type or F216S mutant were isolated by NdeI-BamHI digestion from the pET11b vector and inserted into pET28b (Novagen), in frame with the sequence coding for the N-terminal 6xHis tag. The resulting expression vector was electroporated into E. coli BL21-CodonPlus(DE3) competent cells.
6
Comparative Evaluation of Taq Polymerase Enzymes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A range of 13 high fidelity, regular, economy and premium Taq polymerase enzymes were selected: Biotaq® (Bioline, London, UK), FastStart® High Fidelity PCR System (Roche, Mannheim, Germany), AmpliTaq Gold® (Applied Biosystems, Warrington, UK), HotStarTaq® DNA Polymerase (Qiagen, Hilden, Gernamy), Phusion® High Fidelity DNA Polymerase (Finnzymes, Espoo, Finland), Taq DNA Polymerase (Roche, Maylan, France), i-MaxTM II DNA Polymerase (iNtRON Biotechnology, Seongnam, Korea), KAPA HiFi™ (Kapa Biosystems, Boston, USA), OneTaq™ DNA Polymerase (New England Biolabs, Hitchin, UK), Vent® DNA Polymerase (New England Biolabs, Hitchin, UK), Deep Vent® DNA Polymerase (New England Biolabs, Hitchin, UK), Pwo® DNA Polymerase (Roche, Maylan, France) and Velocity DNA Polymerase (Bioline, London, UK) (abbreviated names in Table 1 ). The list price of these enzymes for the amount recommended for a single 10 μl reaction (not including tax, handling or shipping) ranged from €0.01 to €0.63 (Spain, June 2013).
7
Enzymatic Synthesis and Characterization of Modified Nucleotides
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Oligonucleotides with a length > 100 bp were purchased from GenScript, and other Oligonucleotides were purchased from Sangon Biotech (see sequences used in this study). dNTPs were purchased from Solarbio. Klenow fragment DNA polymerase I was purchased from ABclonal Biotech Co., Ltd. OneTaq DNA polymerase, Deep vent DNA polymerase, glycosylase (UDG), apurinic/apyrimidinic Endonuclease 1 (APE1), as well as T4-DNA ligase, were purchased from New England Biolabs. 2 × UItraSYBR Mixture was purchased from CWBIO Biotech co., Ltd. pBLUE-T Fast Cloning Kits and BL 21 (DE3) Electrocompetent cells were purchased from Zoman Biotechnology Co., Ltd. dNaMTP, dTPT3TP, and dTPT3PA were synthesized as reported (8 (link),24 (link)). NMR spectra were performed on AVANCE NanoBay (400 MHz). HRMS or MS were performed on Bruker compact Ultra-high-resolution electro-spray time-of-flight mass spectrometry and Bruker Autoflex speed MALDLTOF/TOF spectrometry, respectively.
8
Cloning of Bovine LH Beta Subunit
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 13
Cloning of bLH Beta Subunit
RNA was extracted from 3 bovine pituitary glands using Tri-Reagent BD (Sigma cat# T3809). DNA was synthesized using iScript cDNA Synthesis Kit (BioRad cat#170-8890). Primary PCR was performed using the above cDNA, Deep Vent DNA Polymerase (NEB cat# M0258S) and the following primers: bLH-B L 9-9-0 (TTTCCAGAGTTAGGATGGGCATGG) and bLH-B U 9-9-03 (CAAGGATGGAGATGTTCCAGGGAC). Secondary PCR was performed using the primary PCR product as template, Deep Vent DNA Polymerase and the following primers: 5′bglMEbLHb (AGATCTATGGAGATGTTCCAGGGACTG) and 3′bLHbetaR1 (GAATTCAGTGGGGCATCCTTAGAGGAAGAG). Secondary PCR product was gel purified using QiaQuick and adenosine extension reaction was performed using PCR Master Mix (Promega cat# M7501). The product was ligated into pCR2.1 TOPO Cloning Vector (Invitrogen cat# K4500-01). Ligation was transformed into chemical competent Top 10F′ E. coli (Invitrogen cat# C3030-03) and plated onto LB agar with ampicillin. Transformants were analyzed by restriction digest using EcoRI (NEB cat# R0101S) and sequence confirmed by DNA sequencing (Lark Technologies).
9
Receptor Activation Assay for BMS Compounds
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
BMS compounds (BMS493 [32 (link)], BMS614 [20 (link)], BMS411 [20 (link)], BMS948, BMS961 [9 (link)]) were provided by Bristol-Myers Squibb. TTNPB was purchased from Sigma. Am580 was kindly provided by Reinhold Tacke (University of Würzburg). pSG5-based RAR expression vectors were described previously (19). All ligands are in ethanol solutions. (RARE)3x-tk-luc was a kindly gift of Patrick Balaguer (INSERM, Montpellier). hRARβL298F was generated into pSG5-hRARβ by PCR-assisted site-directed mutagenesis with Deep Vent DNA polymerase (New England Biolabs). The construct was verified by DNA sequencing.
10
Inducible Mammalian FLAG-α-Syn Expression
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!