The 2B2t sequence (Hernández-González et al., 2012) [24 (link)] was subcloned into the pGEX-6P-1 expression vector (Cytiva, MA, USA) and a poly-His tag was added at the C-terminus. This construction was used to transform BL21-CodonPlus-RIL Escherichia coli competent cells (Agilent Technologies, Santa Clara, CA, USA). Protein expression was induced by adding 0.1 mM isopropyl-β-D-thiogalactopyranoside (IPTG, Sigma-Aldrich, Saint Louis, MO, USA) at 37°C and shaking (220 rpm) for three hours. A two-step affinity chromatography was performed for protein purification using two different sepharose resins. In the first step, GST-2B2t-poly-His recombinant protein was eluted from a Glutathione Sepharose 4B column (Cytiva, MA, USA) after incubation with L- Glutathione reduced (Sigma-Aldrich, St. Louis, MO, USA). Next, a second purification was performed on a Ni Sepharose 6 Fast Flow column (Cytiva, MA, USA) using 500 mM imidazole (Sigma-Aldrich, St. Louis, MO, USA) for elution. After dialysis against PBS, the purity, integrity and molecular weight of the protein were verified by SDS-PAGE (12%). The concentration was calculated with the Pierce BCA Protein Assay Kit (ThermoScientific, Pierce, IL, USA) and with a BSA protein standard curve (Fig 1 ). The recombinant protein was stored at -80°C until further usage.
Glutathione sepharose 4b column
Manufactured by Cytiva
Sourced in United States, Japan, Spain, United Kingdom
Glutathione-Sepharose 4B column is a chromatography column used for the purification of glutathione-binding proteins. It consists of Sepharose 4B beads coupled with reduced glutathione, which serves as a ligand to capture and purify proteins that have a high affinity for glutathione.
Automatically generated - may contain errors
Lab products found in correlation
Prescission protease, by Cytiva (2 mentions)
Pgex 6p 1 vector, by Cytiva (2 mentions)
Imidazole, by Merck Group (1 mentions)
Pgex 6p 1 expression vector, by Cytiva (1 mentions)
Ni sepharose 6 fast flow column, by Cytiva (1 mentions)
Isopropyl β d thiogalactopyranoside iptg, by Merck Group (1 mentions)
Pierce bca protein assay kit, by Thermo Fisher Scientific (1 mentions)
L glutathione reduced, by Merck Group (1 mentions)
Amicon ultra, by Merck Group (1 mentions)
Isopropyl β d 1 thiogalactopyranoside (iptg), by Thermo Fisher Scientific (1 mentions)
Ni2 nta column, by Qiagen (1 mentions)
Pgex 4t 1, by Cytiva (1 mentions)
Ni2 nta column, by Roche (1 mentions)
Millipore concentrator, by Merck Group (1 mentions)
15 protocols using glutathione sepharose 4b column
1
Recombinant Protein Purification of 2B2t
2
Purification and Characterization of Irgb6
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Irgb6 was purified at 4°C. The frozen BL21(DE3) cells were suspended in solution-I (50 mM HEPES-KOH, pH 7.5, 150 mM NaCl, 2 mM dithiothreitol, 0.7 μM leupeptin, 2 μM pepstatin A, 1 mM phenylmethylsulfonyl fluoride, and 2 mM benzamidine) and sonicated on ice. The cell lysate was centrifuged (80,000g, 30 min) and GST-Irgb6 in the soluble fraction was purified by affinity chromatography using a Glutathione Sepharose 4B column (Cytiva) equilibrated with solution-I. The GST domain of the protein was cleaved by overnight incubation with GST-tagged HRV 3C protease (homemade) on the resin. The free Irgb6 which contains two extra N-terminal residues, Gly–Pro, was eluted with solution-I and was concentrated to with an Amicon Ultra 10-kD MWCO concentrator (Merck Millipore). The protein was further subjected to SEC on a HiLoad 16/600 Superdex 75 column pg column (Cytiva) equilibrated in solution-II (50 mM HEPES-KOH, pH 7.5, 150 mM NaCl, 5 mM MgCl2, and 2 mM dithiothreitol). Peak fraction containing Irgb6 at ∼47 kD elution position was concentrated using the concentrator for crystallization. Protein concentration was estimated by assuming an A280 nm of 0.916 for a 1 mg/ml solution.
3
Protein Purification and Expression in E. coli
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmids encoding hexahistidine (Hisx6)- and glutathione S-transferase (GST)-tagged proteins were introduced into Escherichia coli strain BL21(DE3) CondonPlus RIL (230245, Agilent Technologies, Inc.), and the expression of the recombinant protein was induced by 0.5 mM isopropylthio-β-D-galactoside (IPTG) in Luria Bertani broth at 18°C for 6 h. The Hisx6-fused protein was purified from the cell lysate by Ni-NTA column (141–09764, Fujifilm, Tokyo, Japan) and dialyzed by 200 mM NaCl, 50 mM HEPES, 1 mM β-mercaptoethanol for 6 h at 4°C. The GST-fused proteins were purified by Glutathione Sepharose 4B-column (17127901, Cytiva) and dialyzed by 200 mM NaCl, 50 mM HEPES, 7:100000 (V/V) β-mercaptoethanol (99%) for 6 h at 4°C. The proteins were concentrated by Amicon Ultra (M.W. 3,000 Da) (UFC9003, Sigma-Aldrich) and stored at −80°C. All the recombinant proteins were treated with RNase during bacteria cell lysate preparation.
4
Purification of Gαs and Gαolf Subunits
5
Functional Analysis of C3 Variant
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
As C3 p.W1034R was considered the most probable candidate variant for a causative mutation in this family with aHUS (Zhao et al., 2020 (link); Table S1 ), a functional analysis was conducted using a recombinant glutathione S‐transferase (GST)‐tagged C3 protein in which the amino acid at the 1034 position was substituted with arginine to demonstrate the functional effects of the variant (Supplementary Methods ). Briefly, the PCR‐amplified fragments of C3 from 3004 to 3909 (Figure 2a ), corresponding to C3d, were inserted into the pGEX6P‐1 vector (Cytiva, Tokyo, Japan), and the recombinant GST‐tagged C3d protein was expressed and purified using a glutathione Sepharose 4B column (Cytiva, Tokyo, Japan). Subsequently, the GST tag was removed by overnight incubation with PreScission Protease (Cytiva, Tokyo, Japan) at 4°C. A 3100T>C mutation in C3d introduced into the pGEX6P‐1 vector was induced using a mutagenesis kit (Toyobo, Osaka, Japan). As controls that had been reported to have deleterious effects on the binding between C3b protein and factor H (Schramm et al., 2015 (link)), the vectors harboring the 3187 A > C mutation, which leads to an amino‐acid substitution of serine to arginine (S1063R), and the 3281 C > A mutation, which leads to an amino‐acid substitution of alanine to aspartate (A1094D), were also constructed.
6
Recombinant Protein Production and Purification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The recombinant proteins were produced in transformed BL21 E. coli cultures induced with 100 μM isopropyl-β-D thiogalactopyranoside (IPTG) for 4 h and purified by affinity chromatography using a Glutathione-Sepharose 4B column (Amersham Biosciences, Barcelona, Spain) according to the manufacturer’s instructions. The sarcoptes-derived polypeptide Ssλ20∆B3 was excised from the GST by thrombin cleavage, while the GST-Ssλ15 was either excised from the GST for preparation of specific antisera or directly eluted from the column as a fusion protein with GST with 50 mM Tris-HCl, 10 mM reduced glutathione, pH 8.0 for its use in the vaccination trial. Proteins were analysed by SDS-PAGE and quantified by the Bradford method [26 (link)] using bovine serum albumin as the standard.
7
Purification and Analysis of GST-MCM7 Mutants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Escherichia coli cells harboring pGST-MCM7 mutants or pGST were grown in 100 ml Luria-Bertani medium supplemented with 100μg/ml ampicillin overnight. They were then induced by 1mM IPTG (Thermo Fisher Scientific, USA) for 3 h. The cells were pelleted, resuspended in 1×PBS, and sonicated for 2 min. The proteins were solubilized in 1% Triton X-100. The supernatant was collected after centrifugation at 15,000g for 5 min. The GST, GST-MCM7N, GST-MCM7M, GST-MCM7C mutant fusion proteins were purified through a glutathione-Sepharose 4B column (Amersham Bioscience). The pull-down assays were analyzed by western blot as previously described.
8
Purification and Interaction of HSP90 and USP19
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The His-tagged HSP90 (in pET-28a) and GST-fused CS1 (residues 75–209) or CS2 (273–393) domain of USP19_b (in pGEX-4T-3) were expressed in E. coli BL21 (DE3) strain. The His-tagged HSP90 was purified through a Ni2+-NTA column (Qiagen), while GST-fused proteins were purified using the glutathione Sepharose 4B column (Amersham Bioscience). GST or GST-fused proteins were incubated with the glutathione Sepharose 4B beads in a PBS buffer (10 mM Na2HPO4, 140 mM NaCl, 2.7 mM KCl, 1.8 mM KH2PO4, pH 7.4), and the suspension was agitated at 4°C for 30 min. The beads were washed three times in the same buffer to remove any unbound protein. An equal molar amount of HSP90 was added, and the suspension was agitated at 4°C for about 2 hrs. After excessive washing, the beads were re-suspended in the sample buffer and subjected to SDS-PAGE followed by Coomassie staining.
9
Purification of GST-RalGDS-RBD Fusion Protein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
pGEX Ral GDS-RA, an expression vector for GST-RalGDS-RBD (van Triest et al., 2001 (link)), was transformed into E. coli (strain BL21). Protein production was initiated by addition of isopropyl-β-D-thiogalactopyranoside (IPTG) to the culture. The fusion protein was affinity purified on a glutathione sepharose 4B column (Amersham Bioscience) from the supernatant of bacteria lysed by sonication. GST-RalGDS-RBD pre-coupled to a glutathione sepharose 4B column was added to the cell lysates and incubated at 4 °C for 60–180 min with slight agitation. Beads were washed four times in lysis buffer and subjected to immunoblotting.
10
Recombinant Snail Protein Purification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The sequence coding for Snail was generated from pCMV‐Tag2B‐Snail by PCR with the forward primer 5′‐TCGGAATTC ATGCCGCGCTCTTTCCTCG‐3′ and reverse primer 5′‐TTTCTCGAG TCAGCGGGGACATCCTG‐3′. The products were double‐digested by EcoR I and Xho I and then cloned in a pGEX‐6p‐1 vector (Amersham Biosciences, Buckinghamshire, UK) to construct GST‐tagged Snail (pGEX‐Snail). The Snail‐K187R mutation was generated by PCR‐based site directed mutagenesis (QuickChange Kit, Stratagene, La Jolla, CA, USA) using pCMV‐Tag2B‐Snail as a template with the forward primer 5′‐GAACCTGCGGGAGGGCCTTCTCTAGG‐3′ and reverse primer 5′‐CCTAGAGAAGGCCCTCCCGCAGGTTC‐3′. All constructions were verified by sequencing. Plasmid HA‐p300 expression was obtained from Millipore (Bedford, MA, USA). pGEX‐p300 HAT has been described previously.14 For purification of GST‐Snail, the plasmid pGEX‐Snail was transformed into E.coli strain BL21 (DE3). Recombinant Snail expression was induced by 0.5 mmol/L isopropyl β‐D‐1‐thiogalactopyranoside (IPTG) for four hours at 37°C. The cell lysate was then loaded on a Glutathione Sepharose 4B column (Amersham Biosciences) and GST‐Snail was purified by elute buffer (10 mmol/L reduced glutathione, 50 mmol/L Tris‐hydrochloride [HCl], pH 8.0). Protein concentrations were determined using bicinchoninic acid assay.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!