Lewis lung carcinoma cells (3LL) were kindly provided by Raphael Nemenoff (University of Colorado, Denver, CO, USA) and stably transfected with pCCL-MNDU3-LUC plasmid containing the firefly luciferase gene as previously described (Supplementary Fig. 1, see section on supplementary data given at the end of this article) (Christoph et al. 2013 ). The cell line was validated before start of the experiments by short tandem repeats (Microsynth Seqlab, Göttingen, Germany). Cells were cultured in RPMI 1640 medium (Hyclone Laboratories, Logan, UT, USA) supplemented with 10% fetal bovine serum in 5% CO 2 at 37°C to 65-70% confluence. For the proliferation assay, cells were grown in RPMI 1640 medium with 10% fetal bovine serum (FBS) depleted of TH by treatment of FCS with anion exchange resin (Aldrich Amberlite IRA-400 Cl, Sigma) and charcoal. Thyroid hormone concentration was below the limit of detection after treatment. T 4 , T 3 and Tetrac were dissolved in DMSO, which was also used as control.
Seqlab
Manufactured by Microsynth
Sourced in Germany
Seqlab is a laboratory equipment designed for DNA sequencing. It performs the automated process of determining the precise order of nucleotides within a DNA molecule.
Automatically generated - may contain errors
Lab products found in correlation
Rpmi 1640 medium, by Cytiva (1 mentions)
Pmirglo dual luciferase mirna target expression vector, by Promega (1 mentions)
Fugene hd transfection reagent, by Promega (1 mentions)
Dual luciferase reporter assay system, by Promega (1 mentions)
Stellar competent cells, by Takara Bio (1 mentions)
Phusion site directed mutagenesis kit, by Thermo Fisher Scientific (1 mentions)
Genejet pcr purification kit, by Thermo Fisher Scientific (1 mentions)
Pen strep, by Thermo Fisher Scientific (1 mentions)
Mem alpha medium, by Thermo Fisher Scientific (1 mentions)
Pegfp c1, by Addgene (1 mentions)
Jetpei, by Polyplus Transfection (1 mentions)
8 protocols using seqlab
1
Stable Luciferase-Expressing Lewis Lung Carcinoma Cells
2
miRNA Target Validation Using Luciferase Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Online miRNA target prediction software such as Miranda 1 , miRDB2 , RNA hybrid3 , and miRTarBase4 were used for target mRNA prediction (Figure 2 ). Sense and antisense Oligonucleotides corresponding to the identified target sites were designed in a way that, when annealed, to be flanked by sticky ends resembling those of SacI and XbaI digestion (Supplementary Table 2 ). Target sites were cloned in the pmirGLO Dual-Luciferase miRNA Target Expression vector (Promega, Madison, WI, United States) downstream of the firefly luciferase gene. In brief, the vector was double digested by SacI and XbaI restriction enzymes (Thermo Scientific, United States) and the sticky ended annealed oligonucleotides were inserted into the vector using T4 DNA ligase with 2 h incubation at 16°C. FuGENE HD transfection reagent (Promega) was used to transfect 0.5 μg of each vector in Huh7 cells alone or in combination with 150 ng of miR-let-7a mimics. Forty-eight hours after transfection, luciferase assay was performed using Dual-Luciferase Reporter Assay System (Promega, Mannheim, Germany) according to manufacturer’s instructions. To test for correctness of insert, the constructs were sequenced (SeqLab, Microsynth, Heidelberg, Germany).
3
Yeast Two-Hybrid Screening of Ubiquitin Interactors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Gal4BD-fused hexaUb plasmid was transformed into Y2HGold Saccharomyces cerevisiae strain (Clontech) and used as bait in Y2H screen, where it was mated with the human normalized cDNA library (Clontech) transformed into Y187 yeast strain (prey). Four independent reporter genes (AUR1-C, ADE2, HIS3, and MEL1) were used for selection according to the manufacturer’s instructions. Clone identities were determined by Sanger sequencing (Microsynth Seqlab).
4
Generation of USP11 Knockout RPE1 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
USP11 KO RPE1 cells were generated using the CRISPR/Cas9 technology. Guide RNA sequences targeting spCas9 to the genomic locus of USP11 (Ensembl ID: ENSG00000102226) were designed according to (33 (link)). Specific overhangs for subsequent ligation into pLentiCRISPRv2 (gift from Feng Zhang, Addgene, plasmid #52961) were added to each guide (underlined):
USP11_KO-1-F:CACCG ggtctccatgatgatcaact
USP11_KO-1-R:AAAC agttgatcatcatggagaccC USP11_KO-2-F: CACCG gtgggcgagaacgtccactg
USP11_KO-2-R:AAAC cagtggacgttctcgcccacC USP11_KO-3-F: CACCG tgataggcagtggaacactg
USP11_KO-3-R:AAAC cagtgttccactgcctatcaC Complementary oligonucleotides were annealed for 5 min at 95 °C and subsequently cooled down for 15 min at room temperature (RT). Annealed primers were diluted to 0.5 μM in nuclease-free water and cloned into pLentiCRISPRv2 via BsmBI restriction enzyme (NEB) digest and subsequent ligation with T4 DNA ligase (NEB). Stellar competent cells (Clontech) were transformed with the ligation reaction, and correct clones were identified by Sanger sequencing (Microsynth Seqlab) using the U6 primer.
USP11_KO-1-F:
USP11_KO-1-R:
USP11_KO-2-R:
USP11_KO-3-R:
5
Site-Directed Mutagenesis of pET28a_HisFwt
6
Genotype Verification of M. acetivorans Mutant
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The genotype of the M. acetivorans mutant strain Mko4551 was verified by PCR using the primer pairs Ma5/Ma6 and DD15/DD73 (Supplementary Table 3 and Fig. 2 ). The respective PCR products were analysed by agarose gel electrophoresis, purified using the GeneJET PCR Purification Kit (Thermo Fisher Scientific) and sequenced (SeqLab, Microsynth AG).
7
Transient Expression of Ion Channels in CHO Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CHO dhFR− cells (ATCC Cat# CRL‐9096, RRID:CVCL_1977) were maintained as previously reported (Leitner et al., 2016 ). In brief, cells were maintained in MEM alpha medium (with 10% fetal calf serum and 1% pen/strep; all Invitrogen GmbH, Darmstadt, Germany) at 5% CO2 and 37°C in a humidified atmosphere. Transient transfection of cultured CHO cells was performed using jetPEI (Polyplus Transfection, Illkirch, France). The following vectors for ion channel expression were used: Kv11.1 (Erg1)–pcDNA3.1 (gene: rat Kcnh2; UniProt accession number: O08962; UniProt , RRID:SCR_002380), Kv12.1 (Elk1)–pcDNA3.1–IRES–eGFP (human KCNH8 ; Q96L42), and pEGFP–C1 (transfection control; Addgene, Teddington, UK). An amino acid exchange (H462Y) was introduced into Kv12.1 with the QuikChangeII XL site‐directed mutagenesis kit (Stratagene, Santa Clara, CA). Site‐directed mutagenesis was confirmed by sequencing prior to the experiments (Microsynth SEQLAB, Göttingen, Germany).
8
Expression Plasmids for SARS-CoV-2 Research
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We employed expression plasmids encoding the VSV glycoprotein (VSV-G) (41 (link)), Machupo virus glycoprotein (MACV-GPC) (42 (link)) (kindly provided by M. Farzan), influenza A virus strain A/WSN/33 (H1N1) hemagglutinin and neuraminidase (WSN-HA/NA) (43 (link)), and WT MERS-S (10 (link)), which have been described elsewhere. In addition, we employed overlap extension PCR to generate MERS-S mutants harboring single (L411F, F473S, D510G, and I529T) mutations in the RBD (primer sequences and detailed information on the cloning procedure are available upon request). For all S proteins, we also generated versions containing a C-terminal V5 epitope for detection by immunoblotting. Expression plasmids for TMPRSS2 N-terminally fused to a cMYC epitope and DPP4 N-terminally fused to DsRed (EU827527.1 and DsRed-DPP4) were constructed by amplifying the genetic information from existing expression plasmids and cloning the respective open reading frame (ORF) into the pQCXIP plasmid (kindly provided by A. L. Brass). For the TMPRSS2 expression vector, we further exchanged the selection marker for puromycin resistance by that for blasticidin resistance, which was taken from plasmid pcDNA6/TR vector (8 (link), 44 (link)). All PCR-amplified sequences were subjected to automated sequence analysis (Microsynth SeqLab) to verify their integrity.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!