The humanized ChR2(D156A)-YFP gene (hChR2(D156A)-YFP) was cloned into the pTRE3G-IRES plasmid (Clontech, Mountain View, CA, USA) by using the In-Fusion HD Cloning Kit (Clontech). The pTRE3G-IRES plasmid was digested with EagI and MluI and the PCR-amplified hChR2(D156A)-YFP (F: TCTATCGATCGGCCGGATCCACCATGGACTACG, R: TAGCCATATGACGCGTCTTTACTTGTACA GCTCGTCC) inserted.
Ptre3g ires plasmid
Manufactured by Takara Bio
Sourced in United States
The PTRE3G-IRES plasmid is a laboratory tool used for gene expression studies. It contains an internal ribosome entry site (IRES) sequence that allows for the translation of two separate genes from a single mRNA transcript. This plasmid can be used to co-express two proteins of interest simultaneously in a cellular system.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using ptre3g ires plasmid
1
Cloning hChR2(D156A)-YFP into pTRE3G-IRES
2
Fluorescent Protein Insertion Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In the next step, the pTRE3G-IRES plasmid (Clontech, Palo Alto, CA, USA) was cleaved with BglII and BamHI, to release the IRES component and insert either of the fluorescent proteins mCherry or GFP.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!