Quantifluor st blue fluorescence system

Fecal microbial DNA was extracted according to the QIAamp FAST DNA Stool Mini-Kit (Qiagen, Germany) kit instructions. The V3+V4 region of the 16S rDNA gene was amplified using the universal primers 338F (5′-barcode-ACTCCTACGGGAGGCAGCA-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3′). The polymerase chain reaction (PCR) conditions were as follows: predenaturation at 95°C for 3 min; 95°C for 30 s, 55°C for 30 s, and 72°C for 45 s for a total of 27 cycles; and, finally, 72°C for 10 min. The PCR amplification product was separated by 2% agarose gel electrophoresis, and the PCR product was recovered using an AxyPrep DNA Gel Recovery Kit (AXYGEN) and then quantitatively detected by a QuantiFluor^TM-ST Blue Fluorescence System (Promega). The library was built and sequenced according to the Illumina MiSeq platform-related process. The obtained raw data were optimized to remove bases with a tail mass value of 20 or less, to filter reads with an overlap length >10 bp, to filter reads at a mismatch ratio >0.2 in the overlap region of the splicing sequence, and to remove reads with a mismatched barcode sequence. The optimized sequence was divided into operational taxonomic units (OTUs) by Usearch (version 7.0), and statistical analysis of the biological information was usually performed at the OTU of 97% of similarity.

Genomic DNA was extracted from the intestinal contents using a bacterial DNA isolation kit (Foregene Company, Limited, China), according to the manufacturer’s instructions. After extraction, the genomic DNA was detected by 1% agarose gel electrophoresis. Samples were used for polymerase chain reaction (PCR) amplification with the forward primer (338F: 5′- ACTCCTACGGGAGGCAGCAG-3′) and the reverse primer (806R: 5′- GGACTACHVGGGTWTCTAAT-3′). The PCR product was detected by 2% agarose gel electrophoresis and purified with the AxyPrep DNA Gel Extraction Kit (Axygen, Corning, NY, United States), quantified using the QuantiFluorTM-ST Blue Fluorescence System (Promega, Beijing, China), and subjected to next-generation sequencing.

Samples of intestinal contents were collected using a bacterial DNA isolation kit (Foregene, Chengdu, China), and each DNA sample was tested for quality and integrity using a 1% agarose gel. PCR amplification of the variable regions V3 to V4 was performed using primers 338-F (5′ ACTCCTACGGGAGGCAGCAG 3′) and 806-R (5′ GGACTACHVGGGTWTCTAAT 3′). The PCR products were mixed in equal amounts according to the PCR product concentrations, and after sufficient mixing, the PCR products were detected by agarose gel electrophoresis with a mass fraction of 2%, and the target bands were subjected to gel recovery using the QIAquick Gel Extraction Kit (Qiagen, Germany). Quantification was performed using QuantiFluorTM-ST Blue Fluorescence System (Promega, Beijing, China). Sequencing libraries were constructed and high-throughput sequencing was performed on the purified samples. The raw data were spliced using FLASH software (version 1.2.11), the spliced sequences were quality filtered by Trimmomatic software (version 0.33), UCHIME software (version 8.1) identifies and removes chimeras. Clustering was performed using USEARCH (version 10.0) at a 97% similarity level to obtain operational taxonomic units (OTUs). Microbial diversity analysis was performed based on the MegiCloud platform to obtain α-diversity index, β-diversity, species annotation and taxonomic analysis.