Cas9-green fluorescence protein (GFP) (cat no.10008100), crRNA, tracrRNA (cat no.1072533), and ATTO550-labeled tracrRNA (cat no. 1075928) were obtained from Integrated DNA Technologies Inc. (Coralville, IA, USA). crRNA was designed to target the tyrosinase gene of C57BL/6 mice (5′-GGGTGGATGACCGTGAGTCC-3′), which participates in melanin biosynthesis [10 (link)]. This gene is specifically expressed in retinal pigment epithelial cells of the eye, choroidal melanocytes, and hair follicle melanocytes in mammals [11 ]. It is possible to discriminate the results of genome editing from the eye color of offspring derived from C57BL/6 × ICR embryos without genetic analysis by knocking out the tyrosinase gene. The nuclease solution for embryo electroporation contained 200 ng/μl Cas9-GFP, 15 μM crRNA, 15 μM tracrRNA or a mixture solution with 7.5 μM tracrRNA and 7.5 μM tracrRNA-ATTO550 in Opti-MEM (Thermo Fisher Scientific Inc., MA, USA) [8 (link)] was prepared just before electroporation.
Atto550 labeled tracrrna
Manufactured by Integrated DNA Technologies
Sourced in United States
ATTO550-labeled tracrRNA is a laboratory reagent used in various molecular biology applications. It consists of a trans-activating CRISPR RNA (tracrRNA) molecule labeled with the fluorescent dye ATTO550. This product is designed to assist researchers in visualizing and tracking the tracrRNA component of the CRISPR-Cas9 system.
Automatically generated - may contain errors
Lab products found in correlation
Opti mem, by Thermo Fisher Scientific (2 mentions)
Crrna, by Integrated DNA Technologies (1 mentions)
Crrna, by Thermo Fisher Scientific (1 mentions)
Tracrrna, by Thermo Fisher Scientific (1 mentions)
Tracrrna, by Integrated DNA Technologies (1 mentions)
α mem, by Thermo Fisher Scientific (1 mentions)
2 protocols using atto550 labeled tracrrna
1
CRISPR-Cas9 Mediated Tyrosinase Knockout
2
Generation of CHO Cell Mutants with Eogt and Pofut1 Knockouts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CHO Lec125 (link) cells with inactivated Pofut1 were previously described as Pofut1 KO-1 (P4–11) and KO-2 (P4–15)36 (link). The Pofut1 deletion was confirmed by western blotting with a rabbit anti-bovine POFUT1 antibody37 (link). To inactivate Eogt, two guide RNAs (GTATGACTACTCCAGCCTCC in exon 1; Eogt2 GTTTGCAGCTATGTCGACGT in exon 2), an ATTO 550-labeled tracrRNA and Cas9 (all from Integrated DNA Technologies, Inc., Coralville, IA) were lipofected into Lec1 cells. After 24 h, ATTO 550+ cells were sorted by flow cytometry and the 3% most positive cells were seeded at 1 cell per well in alpha minimal essential medium (αMEM, Thermo Fisher Scientific, Waltham, MA) containing 10% fetal bovine serum (FBS) and 1% Penicillin–Streptomycin. Lec1 Pofut1 KO-1 cells were transformed by lipofection with the same Eogt gRNAs to generate Eogt:Pofut1 dKO mutants. After 8–10 days, colonies were expanded and characterized. Genomic DNA PCR detected Eogt alleles (Supplementary Figure S1 A) and RT-PCR detected cDNA products (Supplementary Figure S1 B) as described21 (link). Mutants were designated E116 (Eogt KO) and PE316 (Eogt:Pofut1 dKO).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!