Geneporter

Chinese Hamster Ovary cells stably transfected with the 695 amino acid variety of human APP (CHO 695) were maintained in minimum essential alpha media (αMEM; Invitrogen, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum, 1% glutamine, and 1% penicillin/streptomycin (Invitrogen). The cells were passaged as specified in Balan et al. [19 (link)]. The cells were seeded into 6-well plates at a density of 1.25 × 10⁴ prior to transient transfection. CHO 695 cells at 70% confluence were transfected with GenePorter (Genlantis, San Diego, CA, USA) 24 h after plating, following manufacturer’s instructions. In total, 2 μg DNA (GFP, Homo BACE1, Branchiostoma BACE1, Hydra BACE1, Mnemiopsis BACE 1/2 or Monosiga BACE 1/2) and 10 μL transfection reagent were delivered in 1.0 mL serum-free αMEM for five hours. Transfections were stopped by the addition of 1.0 mL serum-containing αMEM. The visual inspection of GFP controls verified successful transfection. Successful localizations of BACE constructs were confirmed with GFP-tagged versions of each BACE construct. Microscopy was performed on an inverted Nikon DIAPHOT 200 compound light microscope (Melville, NY, USA).

The 34 bp HO endonuclease target sequence (agatcttttagtttcagctttccgcaacagtata) was cloned in to the HindIII site of the pREP4/CAT shuttle vector just before the chloramphenicol acetyl transferase (CAT) coding sequence and the plasmid was renamed as HO-CAT plasmid. Further, HO-CAT plasmid was transfected in to 293 T cells which maintain the plasmid episomal due to presence of EBNA-1, under hygromycin selection (Hygromycin B/Calbiochem, Cat # 400052). The cell line was named 293 T-HO-CAT. Similarly HEK293 cells were transfected and selected to produce the 3-HO-CAT cell line. Metnase expressing pCAPP-Metnase-V5 plasmid which was prepared in Robert Hromas’ lab was transfected in to 293 T cells and puromycin (Puromycin Dihydrochloride/MP biomedicals, Cat # 100552) selected to produce the Metnase over expressing 293 T stable cell line. Subsequently, HO-CAT plasmid was transfected into these cells to produce the Met-T-HO-CAT cell line and maintained under dual selection of hygromycin and puromycin. GenePORTER (Genlantis, Cat # T201007) was used as the transfection reagent for all the above mentioned transfections. All the three cell lines were cultured using DMEM with 10% FCS as growth medium at 5% CO2 and 37°C.