Tricaine methanesulfonate ms 222

Manufactured by Merck Group

Sourced in United States, Germany

Tricaine methanesulfonate (MS-222) is a lab equipment product manufactured by Merck Group. It is a white crystalline powder that serves as an anesthetic agent for fish and amphibians. The core function of this product is to temporarily immobilize and sedate aquatic animals for procedures such as handling, transport, or surgical interventions.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

MS-222 (1416 citations) Tricaine (556 citations) Tricaine methanesulfonate (167 citations) Tricaine (MS-222) (26 citations) Methanesulfonate (MS‐222) (2 citations)

41 protocols using tricaine methanesulfonate ms 222

Rainbow Trout Anesthesia Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

In this study, we used 90 adult male rainbow trout (Oncorhynchus mykiss), aged 12–18 months, with a body length of 40–46 cm and weighing 300–450 g, which were obtained from the Ryazanovka Fish Hatchery, Russia. The rainbow trout (Oncorhynchus mykiss) were kept at 16–17°C with a 14/10-hour light/dark cycle and fed once a day. The dissolved oxygen content of the water was 7–10 mg/dm³, which corresponds to a normal level. All experimental manipulations with animals were carried out in accordance with the rules established by the National Scientific Center of Marine Biology (NSCMB), Far Eastern Branch Russian of the Russian Academy of Science (FEB RAS), and by the Commission on Biomedical Ethics of National Scientific Center of Marine Biology of the Far Eastern Branch of the Russian Academy of Sciences (approval No. 3) on February 25, 2018.
Animals were anesthetized by placing in 0.1% solution of tricaine methanesulfonate MS222 (Sigma-Aldrich, St. Louis, MO, USA) for 10–15 minutes.

Pushchina E.V, & Varaksin A.A. (2019). Neurolin expression in the optic nerve and immunoreactivity of Pax6-positive niches in the brain of rainbow trout (Oncorhynchus mykiss) after unilateral eye injury. Neural Regeneration Research, 14(1), 156-171.

+ Open protocol

+ Expand

Bone Formation Dynamics in Medaka and Zebrafish

Check if the same lab product or an alternative is used in the 5 most similar protocols

In order to study the bone-formation process, medaka (12 control and 12 swim-trained fish) and zebrafish (12 control and 12 swim-trained fish) were double labeled by intraperitoneal injections of 2 different fluorochromes. The injections consisted of alizarin red (Sigma Aldrich, St. Louis, MO, USA) on the first day of the experiment (t = 0) and of calcein green (Sigma Aldrich) at the end of the experiment (t = 6 weeks). All fluorochromes were prepared for injection by modification of the method described previously by Atkins and colleagues [15 (link)]. Briefly, alizarin red and calcein green solutions were prepared with 0.2% bicarbonate buffer. Prior to administration, the solutions were sterilized using 0.2 μm Minisart high-flow filters (Sartorius, Göttingen, Germany). Fish were anesthetized with 0.02% tricaine methane-sulfonate (MS-222; Sigma Aldrich) prior to fluorochrome injections. alizarin red and calcein green were injected into the peritoneal cavity under the guidance of a stereo dissection microscope at a dose of 50 mg/kg and 0.5 mg/kg, respectively, using a microsyringe (Microliter syringe; Hamilton, Reno, NV, USA). After injections, fish were allowed to recuperate in an isolated tank containing clean water. All fish recovered uneventfully from all injections, except for 1 medaka that was excluded from the experiment.

Ofer L., Dean M.N., Zaslansky P., Kult S., Shwartz Y., Zaretsky J., Griess-Fishheimer S., Monsonego-Ornan E., Zelzer E, & Shahar R. (2019). A novel nonosteocytic regulatory mechanism of bone modeling. PLoS Biology, 17(2), e3000140.

+ Open protocol

+ Expand

Zebrafish Genetics and Imaging Protocol

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

AB, TU, WIK and EKWILL wild-type, eisspalte (ele/slbp^ty77e), Tg(-8.4neurog1:GFP)^sb1[36 (link)], Tg(lhx5:GFP)^b1205[37 (link)], Tg(atoh7:GFP)^rw021 [67 (link)], Tg(EF1α:mAG-zGem(1/100))^rw0410h and Tg4(Xla.Eef1a1:mKOFP2-cdt1)^rw0405b [38 (link)] zebrafish (Danio rerio) lines were bred and maintained according to standard procedures [68 ]. To prevent pigment formation, 0.003% phenylthiourea (PTU, Sigma) was added to the fish water between 20 and 24hpf. For live timelapse imaging of Fucci lines embryos were anaesthetised in 0.2% tricaine methanesulfonate (MS222, Sigma) in fish water.
Genotyping of the ele^ty77e mutation was performed following PCR analysis of genomic DNA using primers JH-641 (forward 5′- CTCATCAGAAGACAGAAGCAGATCAACTA -3′) and JH-209 (reverse 5′- TTGCCCACCCCTGTTCTA-3′) followed by DdeI restriction digestion of the PCR products to generate 445 bp and 418 bp fragments for the wildtype and mutant alleles respectively. The bold C nucleotide is changed within the primer to create the DdeI restriction site in the ele^ty77e mutant allele. Latterly, a KASP assay (KASP, LGC genomics; ID 1234567890), performed according to the manufacturer instructions was also used for genotyping embryos.

Turner K.J., Hoyle J., Valdivia L.E., Cerveny K.L., Hart W., Mangoli M., Geisler R., Rees M., Houart C., Poole R.J., Wilson S.W, & Gestri G. (2019). Abrogation of Stem Loop Binding Protein (Slbp) function leads to a failure of cells to transition from proliferation to differentiation, retinal coloboma and midline axon guidance deficits. PLoS ONE, 14(1), e0211073.

+ Open protocol

+ Expand

Plasmid-Mediated Immune Modulation in Channel Catfish

Check if the same lab product or an alternative is used in the 5 most similar protocols

Channel catfish (50.0g ±5.0 g) were purchased from a fish farm in Chengdu (Sichuan, China) and acclimatized in the laboratory for 2 weeks before experimental manipulation. The fish were fed a commercial diet daily, and the water was partly replaced every day, maintaining a temperature of 28°C±1°C. Before experiments, fish were randomly sampled from blood, liver, kidney, and spleen, the examination of bacterial recovery indicated no bacteria could be detected and agglutination test showed no reaction between the serum and S. iniae DGX07. Fish were anaesthetized with tricaine methanesulfonate (MS222) (Sigma, Beijing, China) prior to injections and blood collection. The plasmid pcDNA3.1, pcIL-8 and pcENO were diluted in PBS to 250 μg/ml, to obtain pcENO+pcIL-8, the plasmid pcENO was mixed with an equal volumes of pcIL-8.

Wang E., Long B., Wang K., Wang J., He Y., Wang X., Yang Q., Liu T., Chen D., Geng Y., Huang X., Ouyang P, & Lai W. (2016). Interleukin-8 holds promise to serve as a molecular adjuvant in DNA vaccination model against Streptococcus iniae infection in fish. Oncotarget, 7(51), 83938-83950.

+ Open protocol

+ Expand

Medaka Fish Retinal Development Protocols

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

All studies on fish were conducted in strict accordance with the institutional guidelines for animal research and approved by the Italian Ministry of Health; Department of Public Health, Animal Health, Nutrition and Food Safety in accordance to the law on animal experimentation (article 7; D.L. 116/92; protocol number: 00001/11/IGB; approval date June 6, 2011). Tricaine methanesulfonate (MS-222; Sigma Aldrich) was used for ‎euthanasia (200-300mg/L) and anesthesia (0,05%) [41 (link)]. Furthermore, all animal treatments were reviewed and approved in advance by the Ethics Committee of the Institute of Genetics and Biophysics, IGB Animal House, (Naples, Italy).
Samples of the Cab strain of wild-type medaka fish were kept and staged as described previously [42 (link)]. Staging of retinal development in medaka fish was determined in accordance to Kitambi et al. [43 (link)].

Carrella S., Barbato S., D’Agostino Y., Salierno F.G., Manfredi A., Banfi S, & Conte I. (2015). TGF-β Controls miR-181/ERK Regulatory Network during Retinal Axon Specification and Growth. PLoS ONE, 10(12), e0144129.

+ Open protocol

+ Expand

Aging Zebrafish Model for Liver Study

Check if the same lab product or an alternative is used in the 5 most similar protocols

The wild-type (AB) zebrafish (Danio rerio), Tg(fabp10:EGFP), and Tg(fabp10:GrnA/HcRed) were used for experiments at 6 months of age. Approximately 30 fish of mixed sex were kept in recirculation systems (≈28 °C water, pH 7.5–8) in 10 L aquaria under a 14:10 h light/dark cycle; fish were fed twice daily [49 (link)]. Tricaine methanesulfonate (MS-222) (0.125 mg/mL) (Sigma-Aldrich Inc., St. Louis, MO, USA) was used as a zebrafish anesthetic agent, and overdose of MS-222 (500 mg/L) was used for zebrafish euthanasia in all experiments. The animal protocols used in this study were approved by the Institutional Animal Care and Use Committee of Academia Sinica (AS IACUC), Taiwan.

Chiang K.Y., Li Y.W., Li Y.H., Huang S.J., Wu C.L., Gong H.Y, & Wu J.L. (2021). Progranulin A Promotes Compensatory Hepatocyte Proliferation via HGF/c-Met Signaling after Partial Hepatectomy in Zebrafish. International Journal of Molecular Sciences, 22(20), 11217.

+ Open protocol

+ Expand

Circadian Feeding in Goldfish

Check if the same lab product or an alternative is used in the 5 most similar protocols

Two groups of fish maintained under the same 12L:12D photoperiod (lights on at 8 a.m.) were fed with different schedules with automatic feeders to avoid the negative effects of the human feeding activities. One group (n = 36, placed in six aquaria, six fish/tank) was daily fed at mid-photophase (ZT 6, named Scheduled Feeding 6, SF6), and the other one (n = 36, placed in six aquaria) was daily fed at mid-scotophase (ZT 18, named SF18). Three weeks later, goldfish were sampled each 4 h throughout a 24 h cycle (one tank (n = 6) per sampling time at ZT 5, ZT 9, ZT 13, ZT 17, ZT 21, and ZT 1). Blood was collected from the caudal vein of anesthetized animals (tricaine methanesulfonate, MS-222, 0.14 g/l; Sigma-Aldrich, Madrid, Spain), and plasma was obtained after blood centrifugation and stored at -80°C until assay. Fish were then sacrificed by anesthetic overdose (MS-222, 0.28 g/l), and hypothalamus, head kidney, and liver were quickly collected, frozen in liquid nitrogen and stored at -80°C until analysis.

Gómez-Boronat M., Sáiz N., Delgado M.J., de Pedro N, & Isorna E. (2018). Time-Lag in Feeding Schedule Acts as a Stressor That Alters Circadian Oscillators in Goldfish. Frontiers in Physiology, 9, 1749.

+ Open protocol

+ Expand

Euthanasia and Tissue Harvesting

Check if the same lab product or an alternative is used in the 5 most similar protocols

All procedures for animal handling and tissues removal have been carried out with the most care to avoid any suffering or harm to the animals according to the recommendations of the Ethical Committee of the University of Calabria and with the approval of the “Ministero dell'Ambiente e della Tutela del Territorio (Direzione per la Protezione della Natura)”, permit number 2004/30911.
Each larva, was euthanized by immersion in a solution of 0.1% tricaine methane sulfonate (MS‐222, Sigma‐Aldrich Chemicals Co., St. Louis, MO, USA), before the dissection phases. Gills and small pieces of skin, together with the underlying dermal and muscular layers, were quickly excised and placed into the appropriate fixative solution for subsequent steps of the processing procedures.

Brunelli E., Macirella R., Curcio V., D'Aniello B, & Di Cosmo A. (2022). The differential role of Leydig cells in the skin and gills of Lissotriton italicus larvae. Microscopy Research and Technique, 85(6), 2113-2122.

+ Open protocol

+ Expand

Fish Welfare in Experimental Procedures

Check if the same lab product or an alternative is used in the 5 most similar protocols

All fish were handled according to the European Union regulations concerning the protection of experimental animals (Dir 2010/63/EU). Experimental protocols were approved by the Animal Experiments Inspectorate (AEI), Danish Ministry of Food, Agriculture and Fisheries (permit number: 2020-15-0201-00768). Broodstock was anaesthetised individually before tagging, biopsy, and stripping of gametes, and euthanised after stripping (females) or at the end of the experiment (males) by submergence in an aqueous solution of ethyl p-aminobenzoate (benzocaine, 20 mg/L, Sigma Aldrich, Germany) [29 (link)]. Larvae were anaesthetised and euthanised using tricaine methanesulfonate (MS-222, Sigma Aldrich, Germany) at a concentration of 7.5 and 15 mg/L, respectively [29 (link)].

Bandara K.A., Benini E., Politis S.N., Conceição L.E., Santos A., Sørensen S.R., Tomkiewicz J, & Vadstein O. (2023). Exploring bacterial community composition and immune gene expression of European eel larvae (Anguilla anguilla) in relation to first-feeding diets. PLOS ONE, 18(7), e0288734.

+ Open protocol

+ Expand

Ethical Handling of Eels and Larvae

Check if the same lab product or an alternative is used in the 5 most similar protocols

Eel in all stages were handled in accordance with the European Union regulations concerning the protection of experimental animals (Dir 2010/63/EU). The experimental protocols were approved by the Animal Experiments Inspectorate of the Danish Ministry of Food, Agriculture and Fisheries (permit number: 2020-15-0201-00768). Eels were anesthetized in relation to tagging, biopsy, and stripping of gametes, and euthanized after stripping (females) or at the end of the experiment (males) by submergence in an aqueous solution of ethyl p-aminobenzoate (benzocaine, 20 mg/L, Sigma Aldrich, Germany). Larvae were anesthetized and euthanized using tricaine methanesulfonate (MS-222, Sigma Aldrich, Germany) at a concentration of 7.5 and 15 mg/L, respectively.

Benini E., Bandara K.A., Politis S.N., Engrola S., Nielsen A., Conceição L.E., Santos A., Sørensen S.R, & Tomkiewicz J. (2023). Exploring first-feeding diets for European eel larval culture: Insights at morphological, nutritional, and molecular levels. PLOS ONE, 18(4), e0283680.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!