The following working concentrations of antibiotics were used: carbenicillin (Solarbio, 50 μg/ml), kanamycin (Solarbio, 50 μg/ml), spectinomycin (Macklin, 50 μg/ml), chloramphenicol (Macklin, 25 μg/ml). PHANTA 2x mix (Vazyme) was used for cloning PCR, and Flash 2x mix (Vazyme) was used for verification PCR and Sanger sequencing (Tsingke Bioscience). All cloning fragments were assembled by Golden Gate assembly (New England Biolabs) or ClonExpress assembly (Vazyme) methods. Plasmids were cloned in DH5α competent cells (HT Health). Synthetic genes were ordered from Tsingke Bioscience. Cloned plasmids were extracted by Tiangen DNA extraction kit. E. coli strain S206055 (link) was used in all aspects of the EvoScan process, including system construction, evolution, and plaque assays. The DH5α strain was used for flow cytometry experiments. Detailed information on the plasmids and selection phage (SP) used in this work is given in Supplementary Table 6.
Golden gate assembly
Manufactured by New England Biolabs
Sourced in United Kingdom
Golden Gate Assembly is a molecular cloning technique used for the rapid and efficient construction of recombinant DNA molecules. It enables the seamless assembly of multiple DNA fragments in a defined order and orientation in a single reaction.
Automatically generated - may contain errors
Lab products found in correlation
Kanamycin, by Solarbio (1 mentions)
Spectinomycin, by Maclin Biochemical Technology (1 mentions)
Chloramphenicol, by Maclin Biochemical Technology (1 mentions)
Carbenicillin, by Solarbio (1 mentions)
Luciferase assay substrate, by Promega (1 mentions)
Phusion enzyme, by New England Biolabs (1 mentions)
Gibson assembly protocol, by New England Biolabs (1 mentions)
In fusion cloning kit, by Takara Bio (1 mentions)
Droplet digital pcr, by Bio-Rad (1 mentions)
Nebuilder hifi dna assembly kit, by New England Biolabs (1 mentions)
X tremegene 9 transfection reagent, by Roche (1 mentions)
12 protocols using golden gate assembly
1
Bacterial Antibiotic Resistance Screening
2
Timp1 Promoter Characterization and CRISPR Knockdown
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mouse Timp1 promoter (-1205 to + 63) was amplified with Phusion enzyme (New England Biolabs) and subcloned into NheI-XhoI site of pGL3-basic vector. Reporter assay was done in 293 A cells3 (link) with Luciferase Assay Substrate (Promega). Relative promoter activities were expressed as relative luminescence units normalized to co-transfected β-galactosidase activities in the cell. Three shRNAs (shTimp1-1: 5′-CACCCCTCTTGTTGCTATCACTGATCTCGAGATCAGTGATAGCAACAAGAGG-3′ shTimp1-2: 5′-CACCCCTGTTTATCTATCCCTTGCACTCGAGTGCAAGGGATAGATAAACAGG-3′ shTimp1-3: 5′-CACCCCACCTTATACCAGCGTTATACTCGAGTATAACGCTGGTATAAGGTGG-3′) corresponding to different regions of Timp1 were cloned into TRISPR2.0 donor plasmids and assembled into AAV9 TRISPR2.0 backbone plasmid using Golden Gate Assembly (New England Biolabs) following a published protocol53 . In total, 2 × 1012 gc viruses/20 g of body weight in 200 μl of saline were i.v. injected via tail vein to mice 2 days before surgery.
3
Plasmid Construction Using Gibson and Golden Gate
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A list of plasmids and primers used in this study can be found in Table 1 (plasmids) and Tables S1 and S2 in the supplemental material (primers). The construction of all plasmids is detailed in Text S1. The plasmids used in this study were constructed using either the Gibson assembly protocol from New England BioLabs (NEB) (47 (link)) or Golden Gate assembly from NEB (48 (link), 49 (link)) cloning techniques. For Golden Gate assembly, the primers were designed using the NEB Builder assembly tool.
4
Cloning and Verification of Engineered Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genes encoding for selected designs were ordered from Twist Bioscience and codon-optimized for E. coli. Genes were inserted in the pET28 vector using BsaI restriction sites previously cloned using QuickChange. All plasmids were sequence verified. Designs selected directly from FACS sorting were transferred from the pBAD vector into pET28 by PCR amplifying (KAPA HiFi HotStart ReadyMix) the insert with primers and adding BsaI recognition sites. Amplicons were purified and inserted into a pET28 vector with BsaI insertion sites using Golden-Gate assembly (New-England Biolabs, #M202 and #R3733, respectively). All plasmids were individually verified using Sanger sequencing.
5
Generation of NPC1 and NPC2 Knockout Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Guide sequences to produce NPC1 and NPC2 KO cells were obtained using the CRISPR design tool: NPC1: (fwd: CACCGCCAAGGGCCAGGCCGCGAG; rev: AAACCTCGCGGCCTGGCCCTTGGCG); NPC2: (fwd: TAATACGACTCACTATAGGTCCTTGAACTGCACC; rev: TTCTAGCTCTAAAACAACCGGTGCAGTTCAAGGA). The sequences were used to insert the target sequence into the pX330 vector using Golden Gate Assembly (New England Biolabs) and transfected into cells. Knockout clones were isolated by serial dilution and confirmed by RT–PCR, Western blotting and filipin staining.
6
Cloning and Packaging of Multiplexed sgRNA AAV
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The sgRNA targeting mouse Dmd exon 45, listed in table S2, was first cloned into TRISPR-sgRNA-CK8e–green fluorescent protein plasmid, a modified gift from D. Grimm, using Golden Gate Assembly (New England Biolabs). A detailed cloning protocol was previously described (23 (link)). The sgRNA expression cassette containing three copies of the same sgRNA driven by the U6, H1, and 7SK promoter was PCR-amplified and subcloned into the pSJG scAAV plasmid, a gift from S. Gray, or into the pSSV9 single-stranded AAV plasmid (ssAAV plasmid), using In-Fusion Cloning Kit (Takara Bio). A 2.3-kb stuffer sequence was cloned into the ssAAV plasmid for optimal viral packaging. Both the scAAV and the ssAAV genome contain the same sgRNA expression cassette, consisting of three copies of sgRNA sequence driven by three RNA polymerase III promoters. Cloning primers are listed in table S2. All AAV viral plasmids were column-purified and digested with Sma I and Ahd I to check ITR integrity. AAVs were packaged by Boston Children’s Hospital Viral Core, and serotype 9 was chosen for capsid assembly. AAV titers were determined by Droplet Digital PCR (Bio-Rad Laboratories) according to the manufacturer’s protocol. Primers and probes used for titration are listed in table S2.
7
CRISPR Plasmid and AAV-based Gene Editing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The pSpCas9(BB)-2A-GFP (PX458) plasmid contained the human codon optimized SpCas9 gene with 2A-EGFP. pSpCas9(BB)-2A-GFP (PX458) was a gift from F. Zhang (Addgene plasmid; catalog no. 48138) (21 (link)). Cloning of sgRNA was done using Bbs I sites. The sgRNAs in this study, listed in table S1, were selected using prediction of crispr.mit.edu . sgRNA sequences were cloned into PX458 and then tested in tissue culture using human embryonic kidney (HEK) 293 cells and 10T½ cells, as previously described (37 (link)).
The AAV TRISPR-sgRNAs-CK8e-GFP plasmid contained three sgRNAs driven by the U6, H1, or 7SK promoter and green florescent protein (GFP) driven by the CK8e regulatory cassette. The TRISPR backbone cloning system relies on two consecutive steps of the Golden Gate Assembly (New England Biolabs). Details of the assembly were previously described (11 (link)).
The AAV TRISPR-sgRNAs-CK8e-GFP plasmid contained three sgRNAs driven by the U6, H1, or 7SK promoter and green florescent protein (GFP) driven by the CK8e regulatory cassette. The TRISPR backbone cloning system relies on two consecutive steps of the Golden Gate Assembly (New England Biolabs). Details of the assembly were previously described (11 (link)).
8
Constructing versatile CRISPR plasmids
9
Constructing versatile CRISPR plasmids
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
pBGC24 (link) was used to construct pBGA by exchanging the cat gene (chloramphenicol resistance) with aac(3)-IV (apramycin resistance) from pMDIAI35 (link) by Gibson assembly (New England Biolabs, UK). pLC10-Apra was constructed by exchanging the aph(3’)-Ia gene (Kanamycin resistance) with the aac(3)-IV gene, by Gibson assembly. Plasmids pLC10-Kan/pLC10-Apra carry the Streptococcus pyogenes cas9 gene under the control of a Ptet promoter inducible by anhydrotetracycline (derived from pWJ15336 (link)), cloned on a thermosensitive pSC101 plasmid backbone with a guide RNA under the control of a Ptrc promoter derived from pCas37 (link) (Addgene plasmid #62225). Single guide RNA (sgRNA) targeting pOXA-48 pemK gene (Fig.1A ) was introduced into pLC10-Kan by golden gate assembly38 (link) (New England Biolabs, UK). pLC10-Apra was constructed by exchanging the aph(3’)-Ia gene (Kanamycin resistance) with the aac(3)-IV gene, by Gibson assembly.
10
CRISPR-Mediated Knockout Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fwd: CACCGGCACCTATATCTCATCCCC
Rev: AAACGACTGATCCAACTGCAGAGAC
These sequences were used to create insert the target sequence into the pX330 vector using Golden Gate Assembly (New England Biolabs) and transfected into cells as described in the Methods. Knock-out clones were isolated by serial dilution and confirmed by western blotting and activity assays.
Rev: AAACGACTGATCCAACTGCAGAGAC
These sequences were used to create insert the target sequence into the pX330 vector using Golden Gate Assembly (New England Biolabs) and transfected into cells as described in the Methods. Knock-out clones were isolated by serial dilution and confirmed by western blotting and activity assays.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!