Kapa sybr fast

Tumor surface area and percentage was estimated from H&E stained sections, disregarding surrounding stroma by a pathologist, requiring a minimum of 20% tumor cells for analysis. Based on surface area estimates, 1–10 sections of 10–20 µm thickness were cut from FFPE blocks to yield a tumor volume of ~2 mm³. Tumors were macrodissected, placed into Eppendorf tubes and deparaffinized using xylene. Nucleic acids, DNA and RNA, were extracted using the AllPrep DNA/RNA FFPE Kit (80234, QIAgen) following manufacturer’s instructions. Elutions were performed by washing the column two times with 20 µl and 15 µl RNAse free water for RNA and 50 µl and 30 µl buffer ATE for DNA. RNA was stored at −80°C and DNA at −20°C. DNA concentrations were measured with Qubit dsDNA HS Assay Kit (Q32854, Thermo Fisher) on the Qubit Fluorometer (Thermo Fisher). DNA integrity number (DIN) was assessed in samples containing detectable DNA concentrations on the 2200 TapeStation System (Agilent) using the genomic DNA ScreenTape (5067–5365, Agilent). A selection of samples with ranging DIN values were subjected to quality control using TruSeq FFPE DNA Library PrepQC Kit (FC-121–9999, Illumina) and KAPA SYBR FAST (KK4600, Sigma-Aldrich) on QuantStudio 3 (Thermo Fisher). Samples with a delta Cq score of preferably <6 or DIN value of ≥2.3 passed quality assessment and were proceeded with.

RNA was isolated from frozen muscle using a Qiagen RNeasy Plus Kit (Qiagen, 74,136). cDNA was generated using EcoDry RNA to cDNA double-primed Reverse Transcriptase kit (Clontech, #639549). qPCR assays were performed on an ABI StepOnePlus Real-Time PCR System instrument (Applied Biosystems, #4376592) with KAPA SYBR FAST (Sigma, #KM4103) master mix and amplification efficiency-optimized primers (Integrated DNA Technologies, Coralville, IA). The primers used included Taz (forward 5' CCC TCC ATG TGA AGT GGC CAT TCC 3'; reverse 5' TGG TGG TTG GAG ACG GTG ATA AGG 3'; Acehan et al., 2011 (link)) and β-actin (forward 5' AAG AGC TAT GAG CTG CCT GA 3'; reverse 5' ACG GAT GTC AAC GTC ACA CT 3'; Huang et al., 2017 (link)). Threshold cycle (Ct) values were recorded and analyzed using the ΔΔCt method with expression of β-actin used as a reference gene.

The absolute abundances of sul1, sul2, intI1 and the bacterial 16S rRNA gene were quantified by SYBR Green-based qPCR with established primers (Supplementary Table S3) and three technical replicates per sample for all sampling dates and Sites essentially as described before (Adelowo et al., 2020 (link)). As calibration standards we used a 16S rRNA gene fragment from Pseudomonas putida KT2440, inserted into plasmid pGEM (Invitrogen) and cloned in Escherichia coli JM109, and purified PCR products obtained from Citobacter sp. strain EC35 for sul1 and sul2, and from Thauera aromatica K172 for intI1 (both strains from UFZ culture collection). The PCR mixture contained 6.25 μl KAPA SYBR^® FAST (Sigma-Aldrich, MO, United States), 4.75 μl ddH₂O, 0.25 μl each of forward and reverse primer (both at 10 μM) and 1 μl of template. To compensate for PCR biases, 1:10 dilutions of each sample in ddH₂O were prepared in transparent 96 Fast PCR-Plates (Sarstedt, Germany). Measurements were done on a StepOnePlus Real Time PCR System with software version 2.1 (AB Applied Biosystems, MA, United States). Absolute abundances were normalized to copy numbers/100 ml. The relative abundances of ARGs and the intI1 gene were calculated as absolute abundance divided by absolute abundance of the 16S rRNA gene.

RNA was isolated from serum using miRNeasy serum/plasma advanced kit (Qiagen, USA, Cat No. 217204) as per manufacturers protocol. cel-miR-39 (Norgen Biotek, Canada, Cat No. 59000) was used as a spike-in control. cDNA preparation was done using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, USA, Cat No. 4368814) as per manufacturer’s protocol. Stemloop RT primers were used for cel-miR-39, miR-128-3p and miR-195-5p. Primer sequences are mentioned in Table 1.Table 1

List of Primers and sequences.

miRNA	Stem loop RT primer (5′ to 3′)	Forward primer (5′ to 3′)	Reverse primer (5′ to 3′)
cel-miR-39	CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCAAGCTGA	GAGCAGTCACCGGGTGTAAATCAG	GTGTCGTGGAGTCGGCAATTC
hsa-miR-128-3p	CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAAAGAGAC	GGAGTGTCACTTGGCCAGAG	GTGTCGTGGAGTCGGCAATTC
hsa-miR-195-5p	CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGCCAATAT	ACACTCCAGCTGGGTAGCAGCACAGAAAT	GTGTCGTGGAGTCGGCAATTC

For qRTPCR, reaction mixture was prepared using Kapa SYBR fast (Sigma-Aldrich, USA, Cat no. KM4101) dye as per manufacturer’s protocol and PCR was done on Roche lightcycler96 (Roche Diagnostics, Switzerland).

RNA was purified with TRIzol reagent (Life Technologies). 1 μg total RNA was primed with random hexamers and reverse transcribed into cDNA using MultiScribe Reverse Transcriptase (Life Technologies). Amplification of samples without reverse transcriptase assured the absence of genomic or plasmid DNA (data not shown). The relative transcription levels were determined by normalization to GAPDH or β-actin mRNA levels, as indicated. qRT–PCR was performed with KAPA SYBR FAST (Sigma-Aldrich) on Rotor-Gene RG-3000 A (Corbett Research). Primer sequences are listed in Table S10.

Table S10 List of primers, antibodies, inhibitors, and published datasets used in this study.