Anti pol 2

Manufactured by Merck Group

Sourced in United States

Anti-Pol II is a laboratory instrument used to detect and quantify the presence of RNA polymerase II (Pol II), a critical enzyme involved in the transcription of genetic information from DNA to RNA. The product provides a reliable and efficient method for researchers to study gene expression and regulation.

Automatically generated - may contain errors

Lab products found in correlation

9 protocols using anti pol 2

Comprehensive Immunoblotting Methodology

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Immunoblotting was performed as described previously (35 (link)). The following antibodies were used at a concentration of 0.1 to 0.5 μg/ml: anti-pMCM2 (3378-1; Epitomics Inc.), anti-MCM2 (sc-9839; Santa Cruz Biotechnology), anti–pPOL II (04-1571; Millipore), anti–POL II (05-952; Millipore), anti-Lamin B1 (ab16048; Abcam), anti-FANCD2 (sc-20022; Santa Cruz Biotechnology), anti-pCDC6 (ab76422; Abcam), anti-CDC6 (ab109315; Abcam), pChk1 (#2348; Cell Signaling Technology), anti-Chk1 (#2345; Cell Signaling Technology), anti-pCDK1 (#9111; Cell Signaling Technology), anti-CDK1 (sc-954; Santa Cruz Biotechnology), anti-gH2AX (#2577; Cell Signaling Technology), anti-PARP1 (#9542; Cell Signaling Technology), anti–cyclin B1 (sc-752; Santa Cruz Biotechnology), anti-CDC7 (sc-56274; Santa Cruz Biotechnology), anti-DBF4 (ab124707; Abcam), and anti-GAPDH (MAB374; Chemicon). Immunoblotted proteins were visualized by chemiluminescence.

Iwai K., Nambu T., Dairiki R., Ohori M., Yu J., Burke K., Gotou M., Yamamoto Y., Ebara S., Shibata S., Hibino R., Nishizawa S., Miyazaki T., Homma M., Oguro Y., Imada T., Cho N., Uchiyama N., Kogame A., Takeuchi T., Kurasawa O., Yamanaka K., Niu H, & Ohashi A. (2019). Molecular mechanism and potential target indication of TAK-931, a novel CDC7-selective inhibitor. Science Advances, 5(5), eaav3660.

+ Open protocol

+ Expand

Chromatin Immunoprecipitation Validation

Check if the same lab product or an alternative is used in the 5 most similar protocols

ChIP was performed using the SimpleChIP Enzymatic Chromatin IP Kit Magnetic Beads (Cell Signaling Technology). Cross-linked chromatin was incubated with anti-H3 (positive control), anti-IgG (negative control; Cell Signaling Technology), anti-Sp1 (pThr453) (ab59257; Abcam), and anti–Pol II (2019508; Millipore, Billerica, MA) overnight at 4°C with rotation. The precipitated DNA was quantitated by qPCR and normalized by respective 2% input.

Zhu Y.X., Li C.H., Li G., Feng H., Xia T., Wong C.H., Fung F.K., Tong J.H., To K.F., Chen R, & Chen Y. (2020). LLGL1 Regulates Gemcitabine Resistance by Modulating the ERK-SP1-OSMR Pathway in Pancreatic Ductal Adenocarcinoma. Cellular and Molecular Gastroenterology and Hepatology, 10(4), 811-828.

+ Open protocol

+ Expand

Chromatin Immunoprecipitation (ChIP) Assay

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The (chromatin immunoprecipitation) ChIP assay was performed, as previously described [31 (link)]. Cells were crosslinked with 1% formaldehyde for 30 min and then sonicated to shear the chromatin fragments. Sonicated chromatin was immunoprecipitated using an antibody overnight at 4 °C. The antibodies used for the ChIP assay were anti-Pol II (Millipore, Burlington, MA, USA), anti-p65 (Abcam, San Francisco, CA, USA), anti-MLL1 (Abgent, San Diego, CA, USA), and anti-H3K4me3 (Active motif, Carlsbad, CA, USA). After reverse crosslinking by heating, RT-qPCR was performed on the purified DNA fragment using a LightCycler^® 480 II system and SYBR Green I Master (Roche). The results are shown as the mean ± standard deviation (SD), expressed as a percentage of input chromatin. The primers used to amplify the HMOX1 promoter or enhancer region are listed in Supplementary Table S2.

Shin C.Y, & Jeong K.W. (2022). Photooxidation of A2E by Blue Light Regulates Heme Oxygenase 1 Expression via NF-κB and Lysine Methyltransferase 2A in ARPE-19 Cells. Life, 12(11), 1698.

+ Open protocol

+ Expand

Chromatin Immunoprecipitation Assay for NRF2

Check if the same lab product or an alternative is used in the 5 most similar protocols

The chromatin immunoprecipitation (ChIP) assays were performed using the MAGnify™ Chromatin Immunoprecipitation System (Invitrogen, Carlsbad, CA) following the manufacturer’s instructions. Briefly, LNCaP cells treated with DMSO or 5-Aza/TSA for 7 days were washed with PBS and trypsinized. The trypsinized cells were then washed with PBS, and the chromatin from the cells (100,000 cells were used per IP) was cross-linked with 1% formaldehyde for 10 min at room temperature and sonicated to generate ~200- to 500-bp DNA fragments in lysis buffer. The proteins were then immunoprecipitated with 6 to 10 µl of anti-Pol II, anti-MBD2, anti-MeCP2, anti-trimethyl-histone H3-Lys9 (H3K9me3) and anti-H3Ac antibodies (Millipore, MA) or mouse IgG to capture DNA-bound protein complexes. The enrichment of the eluted DNA was quantified by comparison with the input lysate by qPCR (29 ) using designed primers covering a 93-bp fragment that is 29 bp upstream of the first CpG site in the NRF2 promoter (Supplemental Table S1).

Khor T.O., Fuentes F., Shu L., Paredes-Gonzalez X., Yang A.Y., Liu Y., Smiraglia D.J., Yegnasubramanian S., Nelson W.G, & Kong A.N. (2014). Epigenetic DNA Methylation of Anti-oxidative Stress Regulator NRF2 in Human Prostate Cancer. Cancer prevention research (Philadelphia, Pa.), 7(12), 1186-1197.

+ Open protocol

+ Expand

Antibody Characterization for Epigenetic Research

Check if the same lab product or an alternative is used in the 5 most similar protocols

The following antibodies were used in this study. Anti-C/EBPα (sc-61X, lot: G1112), anti-C/EBPβ (sc-150X, lot: L2910), anti-PPARγ (sc-7196X, lot: H1512), anti-p300 (sc-585X, lot: E2209) were from Santa Cruz Biotechnology (Dallas, TX, USA). Anti-CBP (7389S, lot: 1) was from Cell Signaling Technology (Danvers, MA, USA). Anti-MED1/TRAP220 (A300-793A, lot: 2), anti-RbBP5 (AA300-109A), anti-Menin (A300-105A) were from Bethyl Laboratories (Montgomery, TX, USA). Anti-EBF2 (AF7006, lot: CEUA0113081) was from R&D Systems (Minneapolis, MN, USA). Anti-CTCF (07-729, lot: 2054523), Anti-Pol II (17-672, lot: 2015592), anti-H3K4me3 (07-473, lot: 1974075) and Anti-H3K27me3 (07-449, lot: DAM1387952) were from Millipore (Billerica, MA, USA). Anti-H3K4me1 (ab8895, lot: GR61280-1), anti-H3K4me2 (ab7766, lot: GR102810-1), anti-H3K9me2 (ab1220, lot: 957002), anti-H3K27ac (ab4729, lot: GR81163-1), anti-H3K36me3 (ab9050, lot: 947436) were from Abcam (Cambridge, MA, USA). Anti-UTX was described previously (21 (link)). Anti-MLL4 and anti-SET1A were described previously (22 ).

Lai B., Lee J.E., Jang Y., Wang L., Peng W, & Ge K. (2017). MLL3/MLL4 are required for CBP/p300 binding on enhancers and super-enhancer formation in brown adipogenesis. Nucleic Acids Research, 45(11), 6388-6403.

+ Open protocol

+ Expand

Chromatin Immunoprecipitation Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

In accordance with the manufacturer's instructions, ChIP assay was performed by using a ChIP assay kit (Upstate/Millipore, Billerica, MA). Briefly, the indicated HEY cells were grown to 70%–80% confluence on a 100 mm culture dish and treated with 1% formaldehyde for 10 min, which were collected and sonicated to shear the DNA into small, uniform fragments. Equal aliquots of chromatin supernatants were immuno-precipitated overnight at 4°C using ZNF711 (ab254776, Abcam), or anti-JHDM2A (ab191389, Abcam), anti-Flag (F3165, Sigma), anti-Pol II (Millipore, 07-1802), anti-EHMT2 (ab185050, Abcam), anti-H3K9me2 (ab1220, Abcam), anti- H3K9me1 (ab176880, Abcam), anti-H3K27me3 (ab6002, Abcam), anti-H4R17me1 (PTM-697, PTM biolabs, Chicago, IL, USA), antibodies, or an anti-anti-IgG antibody (a negative control, Millipore, Billerica, MA) respectively, with protein G magnetic beads (10003D, Invitrogen). A total of 2 μg of each antibody was used per 10⁷ cells for each ChIP assay. The cross-linked protein/DNA complexes were collected by magnetic pull down, and subsequently eluted from beads using elution buffer. After reverse cross-linking the protein/DNA complexes to free DNA, the enriched DNA fragments was conducted by PCR assays by specific primers. All ChIP primers used in this study are listed in Supplementary Table S3.

Wu G., Peng H., Tang M., Yang M., Wang J., Hu Y., Li Z., Li J., Li Z, & Song L. (2021). ZNF711 down-regulation promotes CISPLATIN resistance in epithelial ovarian cancer via interacting with JHDM2A and suppressing SLC31A1 expression. EBioMedicine, 71, 103558.

+ Open protocol

+ Expand

Chromatin Immunoprecipitation Assay Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

ChIP assays were performed using a Magna ChIP™ G Chromatin Immunoprecipitation Kit (Millipore, 17-611, Guangzhou, China) as previously described [29 (link)]. Briefly, cells were fixed with 4% formaldehyde for 10 min and then scraped after washing with PBS twice. The cells were treated with a cell lysis buffer and sonicated on ice to generate 500–1000 bp DNA fragments. Then, 2–3 μg ChIP-grade antibodies against anti-Pol II (Millipore, 05-623), anti-H3K27ac (Thermo Fisher Scientific, 720096), anti-H3K4me1 (Abcam, ab8895), or anti-FOXA1 (Thermo Fisher Scientific, PA5-27157) were used to perform ChIP assays with protein A/G magnetic beads (MCE). Immunoprecipitated DNA was purified and applied to qPCR and normalized to the input DNA. The sequences of the primers are listed in Supplementary Table S2.

Chen Z., Song X., Li Q., Xie L., Guo T., Su T., Tang C., Chang X., Liang B, & Huang D. (2019). Androgen Receptor-Activated Enhancers Simultaneously Regulate Oncogene TMPRSS2 and lncRNA PRCAT38 in Prostate Cancer. Cells, 8(8), 864.

+ Open protocol

+ Expand

Chromatin Immunoprecipitation (ChIP) Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

ChIP was performed as described previously (18 (link)). Cells were cross-linked for 10 min using 1% formaldehyde. After sonication and pre-clearing, anti-Sp1 (Active-Motif; 39058), anti-H3K4Me3 (Millipore; 04-745), anti-CTCF (Active-Motif; 91285), anti-Pol2 (Millipore; 05-623) and IgG (Santa Cruz Biotechnology) antibodies were used for immunoprecipitation at a concentration of 1 μg per 1 million cells. ChIP eluate was used to perform ChIP-qPCR with specific primers. Primers are shown in Supplementary Table S1.

Akıncılar S.C., Chua J.Y., Ng Q.F., Chan C.H., Eslami-S Z., Chen K., Low J.L., Arumugam S., Aswad L., Chua C., Tan I.B., DasGupta R., Fullwood M.J, & Tergaonkar V. (2022). Identification of mechanism of cancer-cell-specific reactivation of hTERT offers therapeutic opportunities for blocking telomerase specifically in human colorectal cancer. Nucleic Acids Research, 51(1), 1-16.

+ Open protocol

+ Expand

Chromatin Immunoprecipitation for NRF2 and POL2

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Chromatin was isolated from cell pellets using the Magna ChIP G kit (17-611, Millipore, Burlington, MA) per protocol (Millipore). Sonication was performed using the Diagenode Bioruptor Plus for two sets of five 30 s cycles. DNA was quantified using a spectrophotometer, and 50 μg of chromatin was diluted to a total volume of 500 μL in dilution buffer. Antibodies used for immunoprecipitation included rabbit IgG (Millipore), anti-NRF2 (#12721, Cell Signaling Technology, Danvers, MA, USA), and anti-POL2 (05-952-I, Millipore, Burlington, MA, USA). Immunoprecipitations were incubated at 4 °C overnight. Enrichment of the IL-1β promoter was assessed by RT-PCR using SYBR green reagent (Qiagen) primers targeting the IL-1β promoter known to bind DNA polymerase II (POL2) (Fwd AGATGCTCTGGAAGGAAGCA; Rev GGCAGCTCCTGTCTTGTAGG) and NRF2 (F TGATGATGTTGGCAAAGGAA; R AAAAGCTAGAGTGCCCGTCA) [12 (link)]. Results were expressed as fold enrichment over IgG.

Wall S.B., Li R., Butler B., Burg A.R., Tse H.M., Larson-Casey J.L., Carter A.B., Wright C.J., Rogers L.K, & Tipple T.E. (2021). Auranofin-Mediated NRF2 Induction Attenuates Interleukin 1 Beta Expression in Alveolar Macrophages. Antioxidants, 10(5), 632.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!