At the end of culture, we pooled 18 to 30 follicles for each experimental condition, which were immediately flash frozen in liquid nitrogen. RNA was purified from the follicles using the RNeasy Micro Kit (Qiagen, Manchester, UK). RNA quality and quantity were assessed employing NanoDrop technology (ND-1000; Thermo Fisher Scientific) and High Sensitivity R6K ScreenTape System (Agilent, Cheshire, UK). RNA was diluted to a concentration of 50 to 100 ng/μL. RNA was reverse transcribed to complementary DNA (cDNA) using an AccuScript High Fidelity 1st Strand cDNA Synthesis Kit (Agilent Technologies) according to the instructions of the manufacturer. Messenger RNA (mRNA) expression levels were assessed by quantitative polymerase chain reaction using an ABI sequence detection system (Perkin-Elmer Applied Biosystems, Warrington, UK). All analyses were assessed in 10-μL final volume in reaction buffer, containing 2 X Taqman Universal PCR Master Mix (5.0 μL; Thermo Fisher Scientific), probe-primer mix for the target gene (0.5 μL), and 4.5 μL cDNA (100 ng) (39 (link)). All reactions were normalized against the housekeeping genes 18S ribosomal RNA and ribosomal protein L18 (Rpl18) ribosomal RNA. Data were expressed as Δcycle threshold (CT) values [ΔCT = (CT of target gene) − (CT of housekeeping gene)].
Accuscript high fidelity 1st strand cdna synthesis kit
Manufactured by Agilent Technologies
Sourced in United States
The AccuScript High Fidelity 1st Strand cDNA Synthesis Kit is a lab equipment product designed for the synthesis of first-strand cDNA from RNA templates. The kit includes reagents and enzymes necessary for the reverse transcription process.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Turbo dna free kit, by Thermo Fisher Scientific (3 mentions)
Rneasy micro kit, by Qiagen (2 mentions)
Ssoadvanced universal sybr green supermix, by Bio-Rad (2 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Nd 1000, by Thermo Fisher Scientific (1 mentions)
Nanodrop technology, by Thermo Fisher Scientific (1 mentions)
Abi sequence detection system, by Thermo Fisher Scientific (1 mentions)
Taqman universal pcr master mix, by Thermo Fisher Scientific (1 mentions)
Quantstudio 3 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Lightcycler 480, by Roche (1 mentions)
Lightcycler 480 sybr green 1 master, by Roche (1 mentions)
Sybr premix ex taq, by Takara Bio (1 mentions)
Ariamx real time pcr machine, by Agilent Technologies (1 mentions)
Sybr green master mix, by Agilent Technologies (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Power sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions)
Rneasy powersoil total rna kit, by Qiagen (1 mentions)
Qiaamp viral rna kit, by Qiagen (1 mentions)
Phusion high fidelity dna polymerase, by Thermo Fisher Scientific (1 mentions)
29 protocols using accuscript high fidelity 1st strand cdna synthesis kit
1
Quantification of mRNA Expression from Frozen Follicles
2
Quantitative PCR of Collagen and COPII Genes
3
Validating nfascb Knockout in Zebrafish
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To test whether nfascb mRNA was present in nfascbue56 homozygous mutants, total RNA was isolated from pooled embryos sorted at 5dpf for the nfascbue56 mutant phenotype or wildtype embryos, and reverse transcribed using the AccuScript High-Fidelity 1st Strand cDNA Synthesis Kit (Agilent, 200820). The presence of nfascb transcript within the cDNA pool of nfascbue56 versus wildtype embryos was then tested by PCR amplification of a 796 bp fragment using the primer Nfascb_179-795_RT_F 5′-TCCAGTCTTCACATGGACGC-3′ and Nfascb_179-795_RT_R 5′-CGGAACCGATTTGACCCTGA-3′ that bind 179 bp after the start codon of nfascb. Reverse transcription of part of mbpX3 (NCBI RefSeq XM_002665557.4) mRNA was used as a positive control using the primers mbpX3_RT_F 5′-AGAAAGGGAAAGAGACCCCAC-3′ and mbpX3_RT_R 5′-GATCGGCTTTCTCCCAGGTT-3′, and no added reverse transcriptase before PCR amplification as negative control for genomic DNA contamination.
4
Quantitative Analysis of GABA-A Receptor
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was extracted with TRIzol reagent (Invitrogen™, ThermoFisher Scientific; Cat. no. 15596026) following the supplier’s instructions. RNA concentration was determined with an ND-1000 spectrophotometer (Wilmington, DE, USA). We used 0.5 μg of total RNA for each reverse transcription reaction performed with the AccuScript High Fidelity 1st Strand cDNA Synthesis Kit (Stratagene, Agilent Technologies, USA; Cat. no. 200820). The cDNA samples were analyzed by quantitative real-time PCR using the LightCycler 480 SYBR Green I Master (Roche, Florence, SC, USA; Cat. no. 04707516001), and the primers are listed in Table 1 .
HPRT1 was chosen as a suitable reference gene. We performed a relative basic quantitation based on the ΔΔCt method with the LightCycler480 Software (Roche, version 1.2.9.11). Quantitative analysis of gene expression was performed for the α1, α2, and β1 subunits. For the other subunits, only semi-quantitative analysis was performed by RT-PCR, followed by visualization in 1.5% agarose gel.
HPRT1 was chosen as a suitable reference gene. We performed a relative basic quantitation based on the ΔΔCt method with the LightCycler480 Software (Roche, version 1.2.9.11). Quantitative analysis of gene expression was performed for the α1, α2, and β1 subunits. For the other subunits, only semi-quantitative analysis was performed by RT-PCR, followed by visualization in 1.5% agarose gel.
5
Quantitative Analysis of Transcript Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To measure the steady-state level of transcripts, total RNA was extracted from the root tips of 4-day-old seedlings and treated with RNase-free DNase I. One microgram of total RNA was used for the reverse transcription using the AccuScript High Fidelity 1st Strand cDNA synthesis kit (Agilent Technologies, 200820), and 1 µl of resulting first-strand cDNA (20 µl) was used as a PCR template for the quantitative real-time RT-PCR. Quantitative PCR analysis was performed using SYBR Premix EX Taq (Takara, #RR82LR) with an AriaMx real-time PCR machine (Agilent Technologies). EF1 was used as an internal reference to normalize the relative level of each transcript. Each experiment was repeated three times, and each time the experiment included triplicate samples. The raw data underlying the averages are shown in Source Data file.
6
Tobacco Gene Expression Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from tobacco leaves following the aforesaid procedure and treated with RNase-free DNase to eliminate genomic DNA contamination. cDNA was synthesized using the AccuScript High Fidelity 1st Strand cDNA Synthesis Kit (Agilent Technologies, Santa Clara, CA, USA) following the manufacturer’s instructions. Primers sets targeting the genes related to development, stress and pathogenesis were used for expression analysis (Table B in S1 File ). SYBR Green Master Mix (Agilent technologies, Santa Clara, CA, USA) was used for qRT-PCR and obtained data were analyzed using the delta-delta-Ct method [43 (link)]. N. tabacum Elongation factor 1-alpha (EF1α) was used as an internal control [41 (link)]. The following protocol was used for amplification: 94°C for 5 min followed by 35 cycles at 94°C for 30 s, 58°C for 30 s and 72°C for 60 s. The specificity of the individual PCR amplification was checked using a heat dissociation curve from 55 to 95°C following the final cycle of the PCR.
7
Ascl1a Expression Analysis in Retina
8
Quantification of ATP2B4 mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total ATP2B4 mRNA expression was determined by quantitative RT-PCR. Total RNA was isolated and digested with DNase I as previously described (Ho et al. 2010 (link)). The OD260/280 ratio of extracted RNA was kept above 1.95 to ensure purity and integrity. Reverse transcription was performed using total RNA by AccuScript High Fidelity 1st Strand cDNA synthesis kit (Agilent Technology, Santa Clara, CA). Amplification reactions were performed using Power SYBR Green PCR Master Mix (Applied Biosystems) according to manufacturer's protocol. The primers for real-time PCR: PMCA4b-forward: GCAATACCTACCCGATCCCTG; PMCA4b-reverse: ACCGCATTGTTGTTTGTATTGG. GAPDH expression was used to normalize for mRNA loading. Each RNA sample was run in triplicate and repeated in at least three independent treatments.
9
Analysis of Microbial Community from Sediments
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from the sediment in order to analyze the community composition of biologically active microeukaryotes and bacteria. Total RNA was extracted from 2 g of sediment with RNeasy® PowerSoil® Total RNA Kit (Qiagen), following the manufacturer protocol. RNA concentrations were measured with Nanodrop and standardized to a concentration of 80 ng µL−1. RNA extracts were then treated with TURBO DNA-free™ Kit (Invitrogen) to ensure the elimination of DNA traces. Successful DNase treatment was verified through 30-cycle PCR amplification of the 18S rRNA in the RNA extracts, using the same primer pair and PCR conditions as for sequencing preparation, followed by 1% agarose gel electrophoresis. 1 µg of purified RNA was converted to cDNA using the AccuScript High Fidelity 1st Strand cDNA Synthesis Kit (Agilent Technologies), and cDNA products were preserved at − 20 °C until further library preparation for amplicon sequencing.
10
Comprehensive SARS-CoV-2 Genomic Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Viral RNA was extracted from 140 μL of respiratory specimens with Qiagen QIAamp Viral RNA kit (Cat# 52904). Ten microliters of purified RNA were then reverse transcribed with Agilent AccuScript High Fidelity 1st strand cDNA Synthesis kit (Cat# 200820) using Uni1 (5′-AGCRAAAGCAGG-3′) primer. The viral genome was then amplified by PCR using Thermo Scientific Phusion High-Fidelity DNA Polymerase (Cat# F-530). All reactions were performed according to the manufacturers’ instructions. Twelve PCRs were designed to cover as much as possible of the coding regions of the eight genomic segments (primer sequences and specific annealing temperature and elongation time conditions are available in Supplementary Table 6 ).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!