PAXgene-derived RNA was reverse transcribed to cDNA with a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Custom primers and probe sequences for BAFF were designed using the NCBI Nucleotide website and Primer Express software, and ordered from Applied Biosystems Custom Oligo Synthesis Service (Foster City, California, USA). BAFF sequences are as follows: primers 5′-TCGATGTATTCAA AATATGCCTGAA-3′ and 5′-GCAATGCCAGCTGAATAG CA-3′, and probe 5′-6FAM-CACTACCCAATAATTC-MGBNFQ-3′. Quantitative measurement of BAFF was performed using a standard curve created with a custom DNA oligonucleotide with sequence: 5′-TGACTTTGTT TCGATGTATTCAAAATATGCCTGAAACACTACCCAATAATTCCTGC TATTCAGCTGGCATTGCAAAACTGGAA-3′. Quantitative real-time PCR reactions were performed in duplicate using TaqMan Universal PCR Master Mix (Applied Biosystems) using the QuantStudio 12K Flex system (Applied Biosystems). BAFF gene expression levels were normalised against the housekeeping gene GAPDH. GAPDH sequences: primers 5′-ACCACCAGCCCCAGC AA-3′ and 5′-GGGACTCCCCAGCAGTGA-3′, and probe 5′-6FAM-AGCACAAGAGGAAGAGA-3′. GAPDH oligo sequence: 5′-AGACCCCTGGACCACCAGCCCCAGCAAG AGCACAAGAGGAAGAGAGAGACCCTCACTGCTGGGG AGTCCCTGCCACACTC-3′. Statistical analysis and graphing were done with GraphPad Prism software.
Quantstudio 12k flex system
Manufactured by Thermo Fisher Scientific
Sourced in United States, Germany
The QuantStudio 12K Flex system is a real-time PCR instrument designed for high-throughput gene expression analysis, genotyping, and digital PCR applications. The system features 12 reaction blocks, each with 96 wells, allowing for the analysis of up to 1,152 samples simultaneously. The QuantStudio 12K Flex system utilizes advanced optical and thermal technologies to provide reliable and accurate results.
Automatically generated - may contain errors
Lab products found in correlation
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (17 mentions)
Rneasy mini kit, by Qiagen (11 mentions)
Powerup sybr green master mix, by Thermo Fisher Scientific (11 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (10 mentions)
Power sybr green pcr master mix, by Thermo Fisher Scientific (10 mentions)
Trizol reagent, by Thermo Fisher Scientific (10 mentions)
Taqman microrna reverse transcription kit, by Thermo Fisher Scientific (9 mentions)
Trizol, by Thermo Fisher Scientific (9 mentions)
Rneasy kit, by Qiagen (7 mentions)
Quantitect reverse transcription kit, by Qiagen (6 mentions)
Fast sybr green master mix, by Thermo Fisher Scientific (6 mentions)
Taqman assay, by Thermo Fisher Scientific (6 mentions)
Taqman probe, by Thermo Fisher Scientific (6 mentions)
Iscript reverse transcription kit, by Bio-Rad (5 mentions)
Taqman gene expression master mix, by Thermo Fisher Scientific (5 mentions)
Purelink rna mini kit, by Thermo Fisher Scientific (4 mentions)
Nanodrop, by Thermo Fisher Scientific (4 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (4 mentions)
Qscript cdna synthesis kit, by Quantabio (4 mentions)
Rneasy plus mini kit, by Qiagen (3 mentions)
147 protocols using quantstudio 12k flex system
1
Quantitative Real-Time PCR for BAFF
2
Quantitative PCR for Gene Expression
3
Quantitative PCR for Hemosporidian Parasite Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative PCR (qPCR) analysis was conducted to confirm observations made from nested-PCR analysis. We used primers published by Bell et al. (2015) (link). Amplification of the 182 bp of the conserved ribosomal DNA (rDNA) fragment of the haemosporidian parasites was performed with a QuantStudio™12 K Flex System (Applied Biosystems, USA) platform. The reaction mixture contained 3 μl (~60 ng) of template DNA, 0.4 μM of each primer. A total of 7.5 μl of PowerUp™ SYBR® Green Master Mix [SYBR® Green Dye, Dual-Lock™ Taq DNA polymerase enzyme, dNTPs with dUTP/dTTP blend, heat-labile UDG, ROX passive reference dye, and optimized buffer components] (Applied Biosystems, USA) and ddH2O to make a final reaction volume of 15 μl. The amplification conditions were set as follows: 50 °C for 2 min, 95 °C for 2 min, then 40 cycles at 95 °C for 15 s, and 53 °C for 15 s and 72 °C for 1 min. The melting curve settings were at 95 °C for 15 s, 60 °C for 1 min and 95 °C for 15 s. The threshold of the amplification target was set at 0.04. Synthetic DNA fragment (gBlocks®) of P. relictum (as indicated above) was used as a positive control, and ddH2O as a negative control.
4
Quantitative Analysis of Annexin Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted using RNAzol (Molecular Research Center Inc., Cincinnati, OH, USA). RNA (1μg) was reverse transcribed using the High-Capacity cDNA Reverse Transcription Kit (Life Technologies). Quantitative RT-PCR reactions were performed in triplicate in 96-well MicroAmp Fast Optical plates (Applied Biosystems) in a QuantStudio 12K Flex System (Applied Biosystems), using pre-designed and optimized TaqMan gene expression assays (Applied Biosystems). TaqMan gene expression assays used were ANXA1, Hs00167549_m1; ANAX2, Hs01561520_m1; ANXA5, Hs00996187_m1, ANXA6, Hs00XXX_m1 and normalized to GAPDH (Hs02758991_g1) expression. Fold change in expression was calculated by the 2-ΔΔCt method [39 (link)].
5
Lamin Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were frozen at −80°C and then ground up. Total RNA was extracted using an RNeasy kit (Qiagen). Superscript reverse transcriptase (Invitrogen) and oligo(dT) primers were used for reverse transcription. Real-time PCR was performed on a QuantStudio 12 K Flex system (Applied Biosystems) with Power SYBR Green (Applied Biosystems). The amount of amplified transcript was normalized against that of an internal control (rpl32). The following primers were used: Lamin Dm0 forward, 5′-ACGCCACGGTCAAGAGATAG-3′; Lamin Dm0 reverse, 5′-GATTTCCAAATCCAGGGAGA-3′; Lamin C forward, 5′-ATGCTGGTACCGCACATGAT-3′; Lamin C reverse 5′-GGAAACGTTAGCACGGACAC-3′; rpl32 forward, 5′-GCAAGCCCAAGGGTATCGA-3′; rpl32 reverse, 5′-CGATGTTGGGCATCAGATACTG-3′.
6
Quantitative Analysis of Vitamin K Pathway Genes in Breast Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative PCR was used to assess expression of vitamin K pathway related genes in the panel of breast cell lines. RNA was isolated from cells with the Qiagen RNeasy kit (Qiagen, Valencia, CA) and analyzed for concentration and purity on a Nanodrop 1000 Spectrophotometer. cDNA was prepared using Taqman Reverse Transcriptase Reagents (Life Technologies, Grand Island, NY) and analyzed in duplicate using PowerUp SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA) on a QuantStudio 12K Flex System (Applied Biosystems, Foster City, CA). GGCX, VKORC1, and VKORC1L1 primer sequences were obtained from Origene (Rockville, MD) and synthesized by IDTDNA (Coralville, IA). Sequences are listed in Supplementary Table 2 . The ΔΔCt method was used for calculations and Ct values were normalized to 18S. Values presented for cell lines in Figure 2A were expressed relative to relevant control cell lines: HMLE-GFP (top) or HME (bottom). For Figure 2B , data are expressed relative to non-tumorigenic MCF10A cells.
7
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with the RNeasy Plus Mini Kit (QIAGEN) according to the manufacturer’s instructions. RNA (1 μg) was reverse-transcribed into first-strand cDNA with the iScript Reverse Transcription Kit (Bio-Rad Laboratories). Each 20-μL qPCR reaction contained 1X SYBR Green PCR Master Mix (Applied Biosystems), 60 ng of cDNA, and 250 nM of each specific primer. The primer sequences used for the present study are presented in Supplemental Table 2 . qPCR was performed on an Applied Biosystems QuantStudio 12 K Flex system equipped with 96-well optical reaction plates. The specificity of each assay was validated by melting curve analysis and agarose gel electrophoresis of the PCR products. All of the RT-qPCR experiments were run in triplicate, and a mean value was used to determine the mRNA levels. Water and mRNA without RT were used as negative controls. Relative quantification of the mRNA levels was performed using the comparative Ct method with GAPDH as the reference gene and using the formula 2–∆∆Ct.
8
RT-qPCR for Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total messenger RNA was extracted from cells using RNeasy Plus Mini Kit. RNA was reverse transcribed using the SuperScriptTM III First-Strand Synthesis System. The relative transcript levels of genes of interest were determined by RT-qPCR using PlatinumTM SYBRTM Green SuperMix-UDG. All kits were used according to manufacturer’s protocol. Reactions were run and analyzed on Applied Biosystems™ QuantStudio™ 12 K Flex system. See supplementary information for RT-qPCR primers.
9
Quantitative Real-Time PCR Workflow
10
Quantitative Analysis of Aortic Gene and miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA) from homogenized mouse abdominal aortic tissues, human aortic tissues, or cells. The Quantitect reverse transcription kit (Qiagen, Chatsworth, CA, USA) was used to generate cDNA and SYBR Green PCR kit (Invitrogen) was used for real-time qPCR with the QuantStudio 12k Flex system (Applied Biosystems, Foster City, CA) following the manufacturer’s instructions. Primers are listed as follow: human E-selecin, vascular cell adhesion molecule 1 (VCAM1), intercellular adhesion molecule 1 (ICAM1), CCL2, CCL5, CCL8, CXCL9, and GAPDH, and mouse Ccl2, Ccl5, Ccl8, Cxcl9, and Gapdh are listed in Supplementary Table 1 . To amplify mature miRNA sequences, TaqMan MicroRNA Assays kits including hsa-miR-146a (000468), hsa-miR-181b (001098), U6 snRNA (001973), TaqMan MicroRNA Reverse Transcription kit (P/N 4366596), and TaqMan Universal PCR Master Mix (P/N 4304437) were used.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!