The expression of ATIP isoforms was determined in SACC cell lines (SACC-83), 3 pairs of frozen parotid adenoid cystic carcinoma samples and normal parotid tissue samples using ATIP isoform-specific real time RT-PCR assays, as previously described [22 (link)]. In brief, total RNA was isolated using the RNeasy Mini kit (Qiagen, GER). First-strand cDNA was synthesized with MLV-RT (Promega, Madison, WI, USA) using random hexamer primers (Promega, Madison, WI, USA). ATIP isoform-specific real time RT-PCR was performed using exon-specific primer pairs corresponding to 5 ATIP isoforms (ATIP1, ATIP2, ATIP3a, ATIP3b and ATIP4) [22 (link)]. All reactions were performed in triplicate. Melting curve analyses were performed to ensure the specificity of the real time RT-PCR reactions. The data analysis was performed using a modified 2-delta delta Ct method, with PPIA (peptidylprolyl isomerase A) as an internal reference. The clinical material for each category (i.e., PE and PACC) was provided in Additional file 4 : Table S3. The relative copy numbers of each ATIP isoform were calculated as described by Benedetto [4 (link)] and shown in Additional file 5 : Table S4.
Mlv rt
Manufactured by Promega
Sourced in United States
MLV-RT is a reverse transcriptase enzyme derived from Moloney Murine Leukemia Virus (MMLV). It is used for the synthesis of first-strand cDNA from RNA templates in reverse transcription reactions.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy kit, by Qiagen (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Random hexamer primer, by Promega (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Dnase, by Qiagen (1 mentions)
Steponeplus real time system, by Thermo Fisher Scientific (1 mentions)
Sybr select master mix, by Thermo Fisher Scientific (1 mentions)
Rq1 rnase free dnase, by Promega (1 mentions)
Kapa sybr fast qpcr master mix 2x kit, by Merck Group (1 mentions)
Mx3005p real time pcr system, by Agilent Technologies (1 mentions)
Dnase 1, by Thermo Fisher Scientific (1 mentions)
Taqman universal master mix, by Thermo Fisher Scientific (1 mentions)
Random hexamer primer, by Roche (1 mentions)
Cfx connect, by Bio-Rad (1 mentions)
Ssoadvanced sybr green kit, by Bio-Rad (1 mentions)
Prism v7.0a, by GraphPad (1 mentions)
Dnase, by Promega (1 mentions)
Power sybr green pcr master mix 2, by Thermo Fisher Scientific (1 mentions)
Rnaeasy mini kit, by Qiagen (1 mentions)
12 protocols using mlv rt
1
ATIP Isoform Expression in Parotid Adenoid Cystic Carcinoma
2
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cellular RNA was isolated using the TRIzol reagent (Gibco-BRL). The complementary DNA (cDNA) was synthesized from 3 µg total RNA using murine leukemia virus RT (MLV RT; Promega, Madison, WI, USA) with the oligo (dT) priming method in a 50 µL reaction mixture. 2 µL aliquots were amplified in a 20 µL reaction mixture that contained 1U Taq DNA polymerase (Bioneer KAIST, Daejeon, Korea), 250 µM of each deoxynucleotide (dNTP), 10 mM Tris-hydrochloride (HCl; pH9.0), 40 mM KCl and 1.5 mM MgCl2. The same reaction profile was used for all primer sets: an initial denaturation at 94℃ for 1 min, followed by 25 cycles of: 94℃ for 5 sec; 47 to 50℃ for 5 sec; and 72℃ for 30 sec; and an additional 2 min extension step at 72℃ after the last cycle. Amplification reactions specific for the following cDNAs were performed: Beta-actin, collagen type I alpha, collagen type II and aggrecan. Primer sequence of each cDNA was listed on Table 1 . PCR products (5 µL) were analysed by electrophoresis in 2% agarose gels, and detected by staining with ethidium bromide. The intensity of the products was quantified using the BioImage Visage 110 system (BioRad, Hercules, CA, USA).
3
qRT-PCR Analysis of Cdh1 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
mRNA was extracted from wild-type T-REx-293 cells and from clone THAD1-34 cells induced or uninduced with tetracycline for 48 h. Briefly, cells were collected at confluence from a 6-well plate and mRNA was extracted following RNeasy kit’s instructions (QIAGEN) with an additional DNA digestion step with DNase (QIAGEN). RT-PCR was performed on 2 μg of RNA with MLV-RT (Promega). cDNAs from Cdh1 and β-actin as internal control were amplified with specific primers over 20 PCR cycles. Primers for mouse Cdh1: Cdh1_129F (TGCCGGAGAGGCACCTGGAG) and Cdh1_391R (GGTGGTGGTGCCGGTGATGG); primers for β-actin: β-actin_F (CTGGGACGACATGGAGAARA) and β-actin_R (AAGGAAGGCTGGAARAGWGC)].
4
Quantifying Baculovirus Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from each sample was extracted at selected time points as previously described. Genomic DNA was removed using RQ1 RNase-Free DNase (Promega). Reverse transcription was carried out using MLV-RT (Promega). The silkworm housekeeping gene sw22934 was used as an internal control. RT-qPCR was performed using the StepOne PlusTM Real-time System (Applied Biosystems). Ampfication was carried out in a 15 µl reaction mixture containing 1 µl of cDNA, 0.5 mM of each primer and 2×SYBR Select Master Mix (Life Technology, Carlsbad, CA, USA) in each well of a 96-well plate. The reaction procedure was 94°C 10 s, followed by 40 cycles at 95°C for 5 s and 60°C for 40 s. To confirm specific amplification, melting curve analysis was performed. Each expression assay was repeated three times. Student's t-test was used to evaluate statistical significance (P<0.01). Sequences for primers used were as follows: ie-1 forward 5′ TACTTGGACGATTCACAAAG 3′ and reverse 5′ GTGCAAATGTTCGTGTTGTG 3′; vp39 forward 5' ACTTTTCATGATGTCACTGC3' and reverse 5' AGTACTTGCAAATCGACACG 3'; p10 forward 5' GACACGAATTTTAGACGCCATT 3' and reverse 5' CGATTCTTCCAGCCCGTTT 3'; sw22934 forward 5' TTCGTACTGGCTCTTCTCGT 3' and reverse 5' CAAAGTTGATAGCAATTCCCT 3'.
5
Quantitative RT-qPCR Analysis of Liver Transcripts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative real-time reverse transcription (RT) polymerase chain reaction (PCR) was conducted using cDNA from RNA extracted from liver biopsies. Two μg of RNA were used as a template for reverse transcription by murine leukemia virus reverse transcriptase (MLV RT) (Promega, Madison, WI, USA) with oligo d(T)s at 42 °C for 60 min. Real-time PCR was performed in a Mx3005P Real-Time PCR System (Agilent, Santa Clara, CA, USA) using KAPA SYBR FAST qPCR Master Mix (2X) Kit (Sigma-Aldrich, St. Louis, MO, USA) following the manufacturer’s protocol and custom oligonucleotide primers (Table S1 ). The conditions used for cycling were the following: 40 cycles of 95 °C for 10 s, 60 °C for 20 s, and 72 °C for 15 s. Relative mRNA expression was calculated using the ΔΔCt method [42 (link)] and GAPDH mRNA as a normalizer. The two-tailed t-test was used for p-value calculation using default parameters in GraphPad Prism 8.02 (Dotmatics, Boston, MA, USA).
6
Quantification of Coxsackievirus B3 RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For quantification of CVB3 RNA, total RNA was isolated with TRIzol, DNase I digested (ThermoFisher Scientific), and reverse transcribed by MLV-RT (Promega, Mannheim, Germany) in combination with random hexamer primers (Roche, Penzberg, Germany). Quantitative PCR was carried out using the TaqMan universal master mix (ThermoFisher Scientific) and the following primers and probes: human HPRT, 5′-AGT CTG GCT TAT ATC CAA CAC TTC G-3′ (forward), 5′-GAC TTT GCT TTC GGT CAG G-3′ (reverse), and 5′-TTT CAC CAG CAA GCT TGC GAC CTT GA-3′ (probe); CVB3, 5′-CCC TGA ATG CGG CTA ATC C-3′ (forward), 5′-ATT GTC ACC ATA AGC AGC CA-3′ (reverse), and 5′-FAM-TGC AGC GGA ACC G-MGB3′ (probe). A StepOnePlus real-time PCR system was used for quantitative PCR. Expression data were normalized to the expression level of the housekeeping gene HPRT and the RNA level after infection (0 h p.i.) for each virus strain by following the 2−ΔΔCT method.
7
Quantifying Gene Expression in Drosophila
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For all experiments utilizing RT-qPCR, total RNA was extracted from pools of 20 flies using a standard TRIzol (Invitrogen) extraction. RNA samples were treated with DNase (Promega), and cDNA was generated using murine leukemia virus reverse transcriptase (MLV-RT) (Promega). qPCR was performed using the SSO Advanced SYBR green kit (Bio-Rad) in a Bio-Rad CFX-Connect instrument. Data represent the relative ratio between the Ct value of the target gene and that of the reference gene RpL32 (also known as Rp49). Mean values of at least three biological replicates are represented ±SE. Data were normalized and then analyzed using an unpaired t-test in Prism (GraphPad Prism V7.0a; GraphPad Software, La Jolla, CA, USA). The primer sequences used in this study are available in S6 Table .
8
Quantitative Real-Time PCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cell RNA was extracted with the RNAeasy mini kit (Qiagen, Valencia, CA, USA). 2 μg of RNA were treated with turbo DNAse (Ambion, Grand Island, NY, USA) and reverse transcribed with random primers or oligo dT using MLV-RT (Promega, Madison, WI, USA). 5 μl of a 1:15 dilution of cDNA were used for QPCR with specific primers (Supplementary file 1A ) and Power SYBR Green PCR master mix 2× (Applied Biosystems, Forest City, CA, USA) for 40 cycles in a 7300 real-time PCR system (Applied Biosystems, Forest City, CA, USA) according to the manufacturer's instructions. HSP70 Ct was normalized to GAPDH Ct for each condition and this value was related to the control value.
Takara polymerase (TaKara, Moonachie, NJ, USA) was used for PCR following the instructions of the manufacturer.
For ChIP experiments Real-time QPCR was performed in a Stratagene Mx3005p with Brilliant II SYBR Green kits (Stratagene, Netherlands) according to the manufacturer's instructions ans specific primers (Supplementary file 1A ). Data were computed as described (Saint-Andre et al., 2011 (link)).
Takara polymerase (TaKara, Moonachie, NJ, USA) was used for PCR following the instructions of the manufacturer.
For ChIP experiments Real-time QPCR was performed in a Stratagene Mx3005p with Brilliant II SYBR Green kits (Stratagene, Netherlands) according to the manufacturer's instructions ans specific primers (
9
Automated Liver RNA Extraction and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from 20 mg of liver tissue was extracted using the automated Maxwell system (Promega, Madrid, Spain) according to the manufacturer’s instructions and quantified in duplicate using UV absorbance at 260 nm. One microgram of RNA, pre-treated with RNase free DNase, was transcribed into the cDNA using the MLV-RT (Promega) in a final volume of 40 μL following the manufacturer’s protocol. To minimize variation in the reverse transcription reaction, all RNA samples from a single experimental setup were reverse transcribed simultaneously.
10
Quantitative RT-PCR of Mouse Liver Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from piece of snap frozen mouse liver tissue by TRI Reagent® (Sigma-Aldrich). mRNA was transcribed using polyT primers and MLV-RT (Promega, Fitchburg, WI). For RT reaction, SYBR® Green JumpStart™ Taq ReadyMix™ (Sigma-Aldrich) was used. Primers for amplification of mRNA were used as follows: Adam10 (5′-GCTGGGAGGTCAGTATGGAA-3′, 5′-TGGTCCTCATGTGAGACTGC-3′), Adam17 (5′-CCACCACCACGACTCTCAAG-3′, 5′-CAGTCTGCGACACACTTAGAAAC-3′), TnfrI (5′-TAACTGCCATGCAGGGTTCT-3′, 5′-CTGGGGGTTTGTGACATTTG-3′). Data were normalized to Gapdh (5′-CGTCCCGTAGACAAAATGGT-3′, 5′-TTGATGGCAACAATCTCCAC-3′) and Hprt (5′-TCCTCCTCAGACCGCTTTT-3′, 5′-CCTGGTTCATCATCGCTAAT-3′).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!