All specific sequences for assembly of Tds are shown in Supporting Information Table S1 . All the DNA and RNA sequences were synthesized by Takara Bio, Inc. (Dalian, China). DNA sequences were designed by computer program RNA STRUCTURE 5.7. Agarose (biochemical grade) was bought from Sinopharm Chemical Reagent Co., Ltd. Gel red, DNase I, and RNase A were obtained from the KeyGEN Institute of Biotechnology (Jiangsu, China). Lyso-Tracker Green, 4% paraformaldehyde, and DAPI were purchased from Beyotime Biotechnology. 5-Diphenyl-2-H-tetrazolium bromide (MTT, Sigma–Aldrich, USA) were used as received. Lipofectamine®3000 (lipo3000) was obtained from Invitrogen. Polyvinylidene difluoride (PVDF) membranes and the enhanced chemiluminescence (ECL) reagents were obtained from Millipore (USA). The primary antibodies used in this study were rabbit anti-EGFR (Abways, Shanghai, China) and rabbit anti-β-actin (Abways, Shanghai, China). Horseradish peroxidase-conjugated AffiniPure goat anti-rabbit IgG secondary antibody was bought from Abways Technology (Shanghai, China). SYBR® Premix Ex Taq™ II was purchased from Takara Bio, Inc. (Dalian, China). All of the other chemicals and reagents were analytic grade and used without further purification.
Lipofectamine 3000 lipo3000
Manufactured by Thermo Fisher Scientific
Lipofectamine®3000 (lipo3000) is a lipid-based transfection reagent. It is designed for efficient delivery of nucleic acids, including plasmid DNA and siRNA, into a variety of mammalian cell types.
Automatically generated - may contain errors
Lab products found in correlation
Sybr premix ex taq 2, by Takara Bio (1 mentions)
Paraformaldehyde (pfa), by Beyotime (1 mentions)
4 6 diamidino 2 phenylindole (dapi), by Beyotime (1 mentions)
Agarose, by Sinopharm (1 mentions)
Polyvinylidene difluoride pvdf membrane, by Merck Group (1 mentions)
Lysotracker green, by Beyotime (1 mentions)
Trypsin edta, by Thermo Fisher Scientific (1 mentions)
Oleic acid, by Merck Group (1 mentions)
Fetal bovine serum (fbs), by Wisent (1 mentions)
Dulbecco s modified eagles s medium dmem, by Thermo Fisher Scientific (1 mentions)
2 protocols using lipofectamine 3000 lipo3000
1
Detailed Assembly of Tetracycline Aptamer Sensors
2
Intracellular Delivery of miR-33 Antagomirs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MiR-33 antagomirs and Cy5-labeled miR-33 antagomirs (Cy5-antagomirs) were purchased from GenePharma (Shanghai, China). The sequence of miR-33 antagomirs for mice is UGCAAUGCAACUACAAUGCAC; this sequence is the same for mice and humans. MSNs-NH2 were purchased from So-Fe Biomedical (Shanghai, China). Dulbecco’s Modified Eagles’s Medium (DMEM) and Trypsin-EDTA (0.25%) were purchased from Thermo Fisher Scientific (Waltham, USA). Fetal bovine serum (FBS) was purchased from Wisent (Montreal, Canada). Lipofectamine 3000 (lipo3000) was purchased from Invitrogen (Grand Island, NY). Oleic acid (OA) was purchased from Sigma-Aldrich (St Louis, MO, USA). Lovastatin was obtained from Glpbio (Montclair, USA). All other solvents were of an analytical grade. Fresh double-distilled water was used in all the experiments.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!